OUP user menu

Comparison of the influence of small GTPases Arl1 and Ypt6 on yeast cells’ tolerance to various stress factors

Lydie Marešová, Tomáš Vydarený, Hana Sychrová
DOI: http://dx.doi.org/10.1111/j.1567-1364.2011.00780.x 332-340 First published online: 1 May 2012

Abstract

The GTPases Arl1 and Ypt6 are involved in the intracellular transport of vesicles and their fusion with the trans-Golgi network. This work is focused on comparing the roles of these GTPases in the tolerance of Saccharomyces cerevisiae cells to an increased concentration of alkali metal cations and other stress factors. We studied the phenotypes of arl1 or ypt6 deletions in combination with the deletions of genes encoding alkali-metal-cation transporters (ena1-4, nha1, nhx1, and kha1). Salt sensitivity of the arl1 and ypt6 mutants was shown to be independent of the tested cation transporters and electrochemical membrane potential. Phenotype manifestations of ypt6 deletion were usually more prominent than those of arl1 (cells were more sensitive to KCl, NaCl, LiCl, hygromycin B, increased temperature, and increased pH). At suboptimal temperature, the growth inhibition of arl1 and ypt6 mutants was approximately the same, and low pH was the only condition where arl1 mutants grew even worse than ypt6 mutants. Overexpression of the ARL1 gene suppressed the phenotypes of ypt6 deletion; however, this did not work vice versa (additional copies of YPT6 could not replace ARL1). Our results suggest partially overlapping functions of the GTPases in resistance to various stress factors, with Ypt6 being more efficient under physiological conditions and Arl1 more versatile when overexpressed.

Keywords
  • Saccharomyces cerevisiae
  • cation transporters
  • intracellular pH

Introduction

Our laboratory has long been interested in alkali-metal-cation homeostasis in Saccharomyces cerevisiae and other yeasts, studying many aspects of cation transport across cellular membranes, cell tolerance to salts and osmotic stress, pH regulation, and other features of cell physiology influenced by monovalent cations.

There are several more or less thoroughly characterized transport systems directly mediating the transfer of alkali metal cations across the plasma or intracellular membranes of S. cerevisiae (for a review, see Arino et al., 2010). This work considers the active plasma membrane alkali-metal-cation exporters Ena1-4 and Nha1 and two intracellular antiporters, Nhx1 and Kha1. The Ena ATPases (encoded by a tandem of four genes) export alkali metal cations from the cytosol at the expense of ATP hydrolysis, and the Nha1 antiporter uses the energy of the proton gradient built across the plasma membrane by the activity of the H+-ATPase Pma1. Both of the intracellular antiporters (Kha1p, Nhx1p) work via the same mechanism (antiport of alkali metal cations against protons, using the proton gradient generated by vacuolar ATPase), Nhx1p being localized to late endosomes and Kha1p to Golgi membranes. As they take part in the pH regulation of these organelles, these antiporters can have significant influence on vesicle transport regulation (Brett et al., 2005). However, it was shown that many other proteins influence important characteristics of yeast cells, such as salt sensitivity and pH tolerance. We and others have shown that the small GTPases involved in intracellular vesicle transport and fusion also play an important role in the cation homeostasis of yeast cells (Ali et al., 2004; Munson et al., 2004a, b; Maresova & Sychrova, 2010).

We were interested whether the changed salt sensitivity of various mutants is caused by the direct influence of the GTPases on the activity and/or localization of alkali-metal-cation transporters. In a previous work, we showed that the localization of transporters was not changed in mutants lacking the ARL1 gene, arl1 deletion increased salt sensitivity even in the absence of the transporters, and multiple deletions exhibited cumulative effects (Maresova & Sychrova, 2010).

The regulatory role of Arl1p at the level of bringing endosome-derived retrograde vesicles to the membrane of trans-Golgi network (TGN) thus seemed to be the key to its role in stress resistance. There are basically two pathways of vesicle fusion with trans-Golgi membranes, and mutations in these pathways are synthetically lethal (Graham, 2004). Arl1p is a key player in one of them, binding the Imh1p GRIP domain and bringing this potential vesicle-tethering protein to the TGN (Wu et al., 2004). The other potential vesicle tether, GARP, requires another small GTPase, Ypt6, for localization to the TGN. Two golgins (p230/golgin-245 and golgin-97) require Arl1p for TGN localization, whereas its role in recruitment of GCC185 is controversial (Burguete et al., 2008; Houghton et al., 2009). Retrograde vesicle transport from early endosomes to TGN can indirectly influence the cation fluxes, as proposed by (Ali et al., 2004), describing interactions between Nhx1 antiporter, Ypt6 GTPase, and their Gyp6 regulator protein. These connections led us to the idea of broadening our view to find out whether Ypt6p is also involved in cation homeostasis and to compare its characteristics with those of Arl1p.

Materials and methods

Yeast strains

Most of the S. cerevisiae strains used in this study were derivatives of the W303 strain (MATa ade2-1 can1-100 his3-11, 15 leu2-3, 112 trp1-1 ura3-1 mal10) (Wallis et al., 1989). Additional mutations are listed in Table 1. One experiment (intracellular pH measurement) was performed with the BY4742 strain (MATa, his3, leu2, lys2, ura3) and derived mutants arl1, kha1, nhx1, and ypt6, kindly provided by the laboratory of Rajini Rao, Baltimore, MD.

View this table:
1

Saccharomyces cerevisiae derivatives of W303

NameGenotypeReference
WYP0ypt6::loxP-KanMX-loxPThis work
WAR0arl1::loxP-KanMX-loxPMaresova & Sychrova (2007)
CW25nha1::LEU2Kinclova-Zimmermannova et al. (2006)
GW25ena1-4::HIS3Kinclova-Zimmermannova et al. (2006)
BW31ena1-4::HIS3 nha1::LEU2Kinclova-Zimmermannova et al. (2005)
BWY0ena1-4::HIS3 nha1::LEU2 ypt6::loxP-KanMX-loxPThis work
BWA0ena1-4::HIS3 nha1::LEU2 arl1::loxP-KanMX-loxPMaresova & Sychrova (2010)
LMB01ena1-4::HIS3 nha1::LEU2 kha1::loxP-KanMX-loxPMaresova & Sychrova (2005)
LMY0ena1-4::HIS3 nha1::LEU2 kha1::loxP ypt6::loxP-KanMX-loxPThis work
LMA0ena1-4::HIS3 nha1::LEU2 kha1::loxP arl1::loxP-KanMX-loxPMaresova & Sychrova (2010)
AB11cena1-4::HIS3 nha1::LEU2 nhx1::TRP1Maresova & Sychrova (2005)
ABY0ena1-4::HIS3 nha1::LEU2 nhx1::TRP1 ypt6::loxP-KanMX-loxPThis work
ABA2ena1-4::HIS3 nha1::LEU2 nhx1::TRP1 arl1::loxP-KanMX-loxPMaresova & Sychrova (2010)
ABK0ena1-4::HIS3 nha1::LEU2 nhx1::TRP1 kha1::loxP-KanMX-loxPMaresova & Sychrova (2010)
ABYK0ena1-4::HIS3 nha1::LEU2 nhx1::TRP1 ypt6::loxP kha1::loxP-KanMX-loxPThis work
ABAK0ena1-4::HIS3 nha1::LEU2 nhx1::TRP1 arl1::loxP kha1::loxP-KanMX-loxPMaresova & Sychrova (2010)
  • All four ENA genes in tandem were deleted.

Gene deletions

The WYP0, BWY0, LMY0, and ABY0 strains were prepared by deletion of the YPT6 gene in the corresponding parent strain. Cells were transformed by a deletion cassette containing the loxP-KanMX-loxP sequence prepared according to (Güldener et al., 1996), using primers YPT6-Kan2 and YPT6-Kan2R (for primer sequences, see Table 2). The ABYK0 strain was prepared by deletion of the KHA1 gene from the ABY0 strain using the same method (using primers KHA-Kan and KHA-KanR for the deletion cassette), after excision of the KanMX sequence from the YPT6 locus by the Cre recombinase (Güldener et al., 1996).

View this table:
2

Oligonucleotides

NameSequenceDescription
KHA-KanatggcaaacactgtaggaggaattctgtcgggtgtaaatccgttcgtacgctgcaggtcgacForward primer for KHA1 deletion cassette
KHA-KanRttattcagacgaaaaatggtgcacaataagggtgtcaaaacggcataggccactagtggaReverse primer for KHA1 deletion cassette
YPT6-Kan2aaacaaagaagagattaacaatgagcagatccgggaaatcattgacaaagtacaaaattgttcgtacgctgcaggtcgacForward primer for YPT6 deletion cassette
YPT6-Kan2RtagaactgaaatattaggtgctaacactgacaagcgctttgttcctgctcctctgctgtagcataggccactagtggatcReverse primer for YPT6 deletion cassette
YPT6-YatgaccatgattacgaattcgagctcggtacccggggatcctgaagacattgccttcaaagForward primer for YPT6 insertion into YEp352
YPT6-YRacgacgttgtaaaacgacggccagtgccaagcttgcatgccctatagaactgaaatattaggReverse primer for YPT6 insertion into YEp352

Plasmids

The YYPT6 plasmid was prepared by replacing the KHA1 promoter and gene with the YPT6 promoter and gene in the KKY plasmid (Maresova & Sychrova, 2005). The YPT6 coding region (648 bp) with its own promoter (700 bp) was amplified from W303 genomic DNA (using primers YPT6-Y and YPT6-YR), and the PCR product was inserted by homologous recombination into the KKY plasmid linearized with the restriction endonuclease BglII. The resulting plasmid was verified by restriction analysis, and the YPT6 coding region was sequenced.

All other plasmids used in this study are listed in Table 3.

View this table:
3

Plasmids used in this study

NameDescriptionReference
YEp352E. coli/S. cerevisiae shuttle vector, AmpR and uracil selectionHill et al. (1986)
YARL1ARL1 with its own promoter in YEp352Rosenwald et al. (2002)
KKYKHA1 with its own promoter in YEp352Maresova & Sychrova (2005)
YYPT6YPT6 with its own promoter in YEp352This work
pUG6Template for amplification of deletion cassette preparationGüldener et al. (1996)
pHl-UE. coli/S. cerevisiae shuttle vector, AmpR and uracil selection; for pHluorin expression under the regulation of ADH promoterMaresova et al. (2010)

Media and growth assays

Cells were grown on YPD medium (1% yeast extract, 2% bacto peptone, 2% glucose, adenine 15 μg mL−1, 2% agar for solid media). For the cultivation of strains transformed with a plasmid, SC-ura medium was used (0.67% yeast nitrogen base without amino acids, 2% glucose, 2% agar for solid media) with synthetic dropout medium supplement without uracil added after autoclaving. For measurements with pHluorin, SC-ura was prepared from yeast nitrogen base without riboflavin and folic acid (MP Biomedicals) to diminish the background fluorescence.

Drop tests

For the assessment of growth phenotypes, fresh cells of each tested strain were resuspended in water and adjusted to the same initial OD600 = 1.0. Tenfold serial dilutions were prepared, and 3 μL aliquots of each dilution were spotted on appropriate YPD or SC-ura agar plates supplemented as indicated in the text. Plates were incubated at 30 °C (usually for 2 days), and digital grayscale images were obtained using a Nikon Coolpix4500 digital camera.

Membrane potential comparison by diS-C3(3) assay

A comparison of the relative membrane potential was performed as described earlier (Maresova et al., 2006, 2009). Briefly, exponential cells grown on YPD were washed and resuspended in pH 6, 10 mM citrate–phosphate buffer, and 3, 3′-dipropylthiacarbo-cyanine iodide [diS-C3(3)] was added to a final concentration of 0.2 μM. Fluorescence was monitored with an ISS PC1 spectrofluorometer. The excitation wavelength was 531 nm, emission intensities were measured at 560 and 580 nm, and the intensity ratio at equilibrium was compared for the studied strains. Data shown are the average from three independent experiments, and error bars correspond to SD.

pH changes measured in a microplate reader

Intracellular pH was measured in BY4742 cells (and derived mutants) transformed with the pHl-U vector carrying the pHluorin sequence (Maresova et al., 2010). Cells were grown to the exponential phase in SC-ura medium without riboflavin and folic acid. In each well of a 96-well microplate, 50 μL of the cell culture was mixed with 50 μL of either the calibration buffers (2× conc.), or unmodified SC-ura medium (pH 4.7) or the same medium adjusted to pH 2.0 or 8.2. The microplate was incubated for 10 min in a shaker and then read in a SynergyHT microplate reader (BioTek) with emission filter 516/20 nm and excitation filters 400/30 and 485/20 nm.

Calibration buffers (2× conc.) contained 100 mM MES, 100 mM HEPES, 100 mM KCl, 100 mM NaCl, 400 mM ammonium acetate, and 20 mM NaN3; the pH was adjusted with NaOH or HCl. The intracellular pH values of cells resuspended in the media were calculated from the fluorescence ratio using the software Gen5 (BioTek). The pH value of cells in unmodified medium was taken as the starting point, and intracellular pH shifts (ΔpHin) after mixing with the pH 2.0 or 8.2 medium were estimated.

Results

Salt sensitivity

First of all, we compared the influence of Arl1p and Ypt6p on the salt sensitivity of S. cerevisiae strains, both in the presence and absence of the important alkali-metal-cation transporters (Ena1-4 ATPases; Nha1, Nhx1, and Kha1 antiporters). We wanted to know whether the salt sensitivity of strains lacking arl1 or ypt6 gene could be caused by improper delivery of alkali-metal-cation transporters to their place and/or their inappropriate function. Localization of the transporters was not changed in the arl1 or ypt6 mutant (see Supporting Information, Fig. S1).

Figure 1a–c shows that strains devoid of either of these two GTPases are more sensitive to KCl, NaCl, and LiCl in the medium. The increased sensitivity to salts of strains devoid of Arlp or Ypt6p seemed to be independent of alkali-metal-cation transporters in the plasma membrane (Ena1-4p, Nha1p) and the intracellular ones (Kha1p, Nhx1p).

1

Salt sensitivity of strains with various combinations of gene deletions. Cells were grown on YPD plates supplemented with salts as indicated for 2 days at 30 °C. WT, wild type, also in following figures. (a) KCl sensitivity; (b) NaCl sensitivity; (c) LiCl sensitivity.

The ypt6 deletion mutant tolerated lower concentrations of salts than the arl1 deletion mutant in the W303 and BW31 background. With potassium, additional deletions of the genes encoding intracellular alkali-metal-cation/H+ antiporters Kha1 and/or Nhx1 quantitatively shifted the sensitivity of mutants to lower concentrations, but did not qualitatively change the fact that the arl1 mutant is in most cases more sensitive than the corresponding control, and the ypt6 mutant even more than the arl1 mutant (Fig. 1). With sodium and lithium, the additional deletion of kha1 or nha1 diminished the difference between the ar11 and ypt6 phenotypes. Mutant with all deletions at once (ena1-4, nha1, arl1, kha1, nhx1, and ypt6) could not be tested because of the synthetic lethality of the arl1-ypt6 combination.

Localization and function of cation transporters thus cannot be the reason for changed salt tolerance of the mutants lacking Arl1p or Ypt6p. We wondered if perhaps an increased electrochemical membrane potential might be responsible for their increased sensitivity to cations.

Hygromycin B

We tested the sensitivity of the strains to hygromycin B, a positively charged aminoglycoside antibiotic often used (among others) as an indicator for a hyperpolarized/depolarized yeast plasma membrane (Perlin et al., 1988). It was shown previously that some of our proteins of interest (Arl1p, Kha1p, Nhx1p, and Ypt6p) influenced cell tolerance of hygromycin B (Gaxiola et al., 1999; Ali et al., 2004; Munson et al., 2004a, b; Maresova & Sychrova, 2005). However, previous work in our laboratory showed that neither the lack of Arl1p, nor Kha1p, nor Nhx1p had altered the membrane potential (Kinclova-Zimmermannova et al., 2006; Maresova et al., 2006; Maresova & Sychrova, 2010). Figure 2a shows that (as with salts) the ypt6 deletion results in a greater increase in sensitivity to hygromycin B than arl1 deletion in any tested genetic background. As with arl1 deletion (Maresova & Sychrova, 2010), this sensitivity is not caused by an altered membrane potential, as shown by the diS-C3(3) assay in Fig. 2b. The effect of combined deletions (ena1-4, nha1, arl1, kha1, nhx1, and ypt6) is cumulative (Fig. 2a), quintuple mutants being the most sensitive (ABAK and ABYK strains).

2

Hygromycin B sensitivity and relative membrane potential in tested strains. (a) Hygromycin sensitivity of strains with various combinations of gene deletions. Cells were grown on YPD plates supplemented with hygromycin B as indicated for 2 days at 30 °C. (b) DiS-C3(3) staining level reflecting relative electrochemical membrane potential of strains.

Other stress conditions

So we tried to ask another type of question: Is the salt sensitivity of mutants connected directly to cation homeostasis, or is it possibly a more general effect on stress resistance of cells? We chose two different stress conditions unrelated to alkali metal cations – nonoptimal temperatures and pH stress. As shown in Figs 3 and 4, both at suboptimal temperature and increased temperature, both at low pH and high pH, mutants lacking one of the GTPases grow worse than the control strain. So it seems that these two GTPases play much more general role than just an adjustment to high cation content in the growth media.

3

Temperature sensitivity of strains with various combinations of gene deletions and the influence of 1 M sorbitol. Cells were grown on YPD plates supplemented or not with sorbitol for 2 days at various temperatures as indicated.

4

Growth of strains with various combinations of gene deletions at various pH levels. Cells were grown for 2 days at 30 °C on YPD plates, pH adjusted with HCl or KOH as indicated. pH levels above 6 were buffered with 60 mM MOPS.

Cells with defective vesicle transport and fusion usually grow slowly at the restrictive temperature of 37 °C (Stein et al., 2009). The sensitivity of arl1 and ypt6 deletion mutants to increased temperature was reported previously (Li & Warner, 1996; Rosenwald et al., 2002). As the sensitivity of ypt6 mutants to increased temperature can be partially suppressed by sorbitol (Luo & Gallwitz, 2003), we also tested the strains on plates containing 1 M sorbitol. Figure 3 shows several interesting findings. The growth of strains with the ypt6 mutation was inhibited by increased temperature, not just at 37 °C, even 35 °C was sufficient to see the phenotype. Similarly to the results for the ypt6Δ strain observed by Luo & Gallwitz, 1 M sorbitol only had a small effect on their growth. Strains with arl1 deletion were also sensitive to increased temperature, but to a lower extent than those with ypt6 deletion. Sorbitol improved their growth, but not to the level of the wild type (WT). Both arl1 and ypt6 deletion also caused an increased sensitivity to low temperature (22 °C), and sorbitol did not suppress this phenotype at all. Exceptionally, in this case, the ypt6 deletion did not have a significantly stronger phenotype than arl1 deletion. The nhx1 mutation seemed to improve growth at low temperature, but that was probably caused by the TRP1 allele being introduced to the NHX1 locus in those strains (Gonzalez et al., 2008). We concluded from these results that the phenotypes exhibited by the mutant strains might not be caused by an altered transport of the tested chemicals across plasma membrane, but by a modified functionality of the transport vesicles inside the cells.

Transport vesicles play a significant role in the cells’ regulation of cation homeostasis, pH maintenance, and many other physiological functions, and their traffic is influenced by both the alkali-metal-cation/proton exchange and the activity of small GTPases (Ali et al., 2004). We have previously shown that the absence of the Kha1 antiporter and/or Arl1 GTPase causes a sensitivity to increased pH (Maresova & Sychrova, 2010); the nhx1 mutation was shown to impair growth at low pH (Brett et al., 2005). We tested both conditions for various combinations of mutations, and the results are shown in Fig. 4. The nhx1 phenotype at acidic pH was not observed in our experiments, perhaps because the pH was not low enough. On the other hand, both the arl1 and ypt6 mutations caused significant growth inhibition at pH below 3. In contrast to salt and drugs sensitivities, the arl1 deletion phenotype was stronger than that of ypt6. At high pH, the arl1, kha1, and ypt6 mutations hinder growth, and their combination (arl1 kha1; kha1 ypt6) exhibits a cumulative effect. The ypt6 phenotype is also again stronger than that of arl1.

Intracellular pH

Measuring the intracellular pH revealed that the tested mutants (arl1, kha1, nhx1, and ypt6) had slightly increased pHin under standard conditions (Fig. 5a), but they did not exhibit stronger pHin shifts after extracellular pH change, with the exception of the arl1 mutant at acidic pH (Fig. 5b). SC-ura medium, in which the cells were grown, had an initial pH of 4.7; the cell culture grown to the exponential phase acidified the medium to pH 3.6. When cell suspensions were mixed with a pH 8.2 medium (volume ratio 1 : 1, final pHout 6.7), the pHin increased to approximately the same value (slightly above 7) in all strains, thus reflecting a similar difference in ΔpH to the initial difference in pHin between the WT and mutants. After mixing the cell suspension with a pH 2.0 medium (volume ratio 1 : 1, final pHout 2.3), the pHin of the mutant lacking ARL1 gene dropped by more than one unit, which was a significant difference from the other tested strains. This could be an explanation for the extremely slow growth of arl1 mutants on acidic media (Fig. 4). For the other mutants, the inability to grow at high and/or low pH is probably caused by a feature other than an inability to maintain a pHin level comparable to the WT control.

5

The influence of tested mutations on intracellular pH of strains. (a) pHin of cells grown on YNB medium of initial pH 4.7. (b) pHin change after mixing the cell suspension with pH 2.0 or 8.2 medium (volume ratio 1 : 1).

Mutual substitutability

As the arl1 and ypt6 deletions had similar phenotypes in many cases, we decided to test the mutual substitutability of the Arl1 and Ypt6 GTPases. We transformed the strains WAR0 (arl1) and WYP0 (ypt6) with the YARL1 or YYPT6 plasmids to overexpress the ARL1 or YPT6 gene. As shown in Fig. 6, overexpression of the ARL1 gene complements arl1 deletion phenotypes and also suppresses ypt6 deletion phenotypes, while YPT6 overexpressed from the plasmid only complements its own absence, not that of ARL1.

6

Mutual substitutability of GTPases. Cells transformed with plasmids were grown on SC-ura plates supplemented as indicated. Plates were incubated for 2 days at 30 °C (if temperature not otherwise specified in the figure).

Discussion

Previous work by other groups has shown that the absence of a small regulatory GTPase can result in an altered sensitivity to alkali metal cations, and genetic interactions with alkali-metal-cation transporters were suggested (Ali et al., 2004; Munson et al., 2004a, b). In a preceding study, we showed the involvement of Arl1p not only in tolerance to lithium, sodium, and potassium ions, but also to other chemicals and stress conditions (Maresova & Sychrova, 2010). This work extends that insight by adding data about another GTPase, Ypt6, from certain points of view considered a complementary partner of Arl1p in mediating vesicle fusion to the TGN (Graham, 2004).

Phenotype manifestations of ypt6 deletion were usually more prominent than those of arl1 (cells were more sensitive to KCl, NaCl, LiCl, hygromycin B, increased temperature, and increased pH). At suboptimal temperature, the growth inhibition of arl1 and ypt6 mutants was approximately the same, and low pH was the only condition where arl1 mutants grew even worse than ypt6 mutants. Combining arl1 or ypt6 deletion with other deletions sometimes only shifted their sensitivity to weaker stress conditions (e.g. KCl, hygromycin B) and sometimes diminished the difference between them (e.g. NaCl, LiCl, high pH).

We excluded the possibility of alkali-metal-cation transporters’ mislocalization/decreased activity being the reason of salt sensitivity in the strains devoid of the Arl1 or Ypt6 GTPases. Also, the hyperpolarization of the plasma membrane as the reason for the increased cation and drug sensitivity of the ypt6 mutant was disproved. Increased sensitivity of arl1 and ypt6 mutants to cations thus seems to be just one of many aspects of their lower tolerance to stress conditions generally. A recent study on cold sensitivity and vesicle tethering (Benjamin et al., 2011) suggests that not only deletion, but also dysregulation of small GTPases affects endosomal transport and cells’ ability to grow at nonoptimal conditions.

Our work was the first to test the mutual substitutability of these GTPases in response to stress conditions. We show that additional copies of the ARL1 gene can suppress phenotypes of ypt6 deletion, but this does not work vice versa. This suggests partially overlapping functions of the GTPases in resistance to various stress factors, with Ypt6 being more efficient under physiological conditions (overcoming salt stress, hygromycin B toxicity, nonoptimal pH, and high temperature) and Arl1 more versatile when overexpressed and more important for overcoming low pH stress. Additional copies of the Arl1 GTPase can compensate for the absence of Ypt6p either by binding the GARP complex to TGN (Graham, 2004), or by enhancing the Arl1/Arl3-Imh1 vesicle-tethering pathway. It was previously shown that overexpression of another protein in this same pathway also suppressed the ypt6 temperature sensitivity (Tsukada & Gallwitz, 1996). Ypt6p does not interact with Imh1, the function of Arl1p in the Arl1/Arl3-Imh1 tethering pathway is thus irreplaceable by additional copies of Ypt6p, and enhancing the Ypt6-GARP tethering pathway is not sufficient to suppress arl1 deletion phenotypes.

Conclusions

We conclude that vesicle traffic between TGN and endosomes plays a crucial role in the cells’ ability to overcome a broad range of stress conditions. Intracellular GTPases Arl1 and Ypt6 contribute to cells’ tolerance to salts independently of alkali-metal-cation transporters. Further work will be required to decipher the mechanisms of interaction between particular proteins involved in this regulation; however, it is obvious that both the GTPases regulating vesicle tethering (represented here by Arl1p and Ypt6p) and the Kha1 and Nhx1 antiporters are very important not only for regulating cation homeostasis, but also for handling other stresses such as hygromycin B toxicity or nonoptimal pH. The range of influence seems to be broader for the GTPases, as they are also involved in overcoming nonoptimal temperature stress.

Supporting Information

Additional Supporting Information may be found in the online version of this article:

Fig. S1. Localization of GFP-labeled Kha1p (left panels) and Nha1p (right panels) shows that arl1 or ypt6 mutations do not inhibit proper localization (intracellular or plasma membrane) of alkali-metal-cation transporters.

Acknowledgements

We thank Dr Rajini Rao for the strains derived from BY4742 and Dr Anne Rosenwald for the YARL1 plasmid. This work was supported by Czech grants MŠMT LC531, GA AS CR IAA 500110801, and AV0Z 50110509.

Footnotes

  • Editor: Ian Dawes

References

View Abstract