OUP user menu

Yeast genes involved in response to lactic acid and acetic acid: acidic conditions caused by the organic acids in Saccharomyces cerevisiae cultures induce expression of intracellular metal metabolism genes regulated by Aft1p

Miho Kawahata, Kazuo Masaki, Tsutomu Fujii, Haruyuki Iefuji
DOI: http://dx.doi.org/10.1111/j.1567-1364.2006.00089.x 924-936 First published online: 1 September 2006

Abstract

Using two types of genome-wide analysis to investigate yeast genes involved in response to lactic acid and acetic acid, we found that the acidic condition affects metal metabolism. The first type is an expression analysis using DNA microarrays to investigate ‘acid shock response’ as the first step to adapt to an acidic condition, and ‘acid adaptation’ by maintaining integrity in the acidic condition. The other is a functional screening using the nonessential genes deletion collection of Saccharomyces cerevisiae. The expression analysis showed that genes involved in stress response, such as YGP1, TPS1 and HSP150, were induced under the acid shock response. Genes such as FIT2, ARN1 and ARN2, involved in metal metabolism regulated by Aft1p, were induced under the acid adaptation. AFT1 was induced under acid shock response and under acid adaptation with lactic acid. Moreover, green fluorescent protein-fused Aft1p was localized to the nucleus in cells grown in media containing lactic acid, acetic acid, or hydrochloric acid. Both analyses suggested that the acidic condition affects cell wall architecture. The depletion of cell-wall components encoded by SED1, DSE2, CTS1, EGT2, SCW11, SUN4 and YNL300W and histone acetyltransferase complex proteins encoded by YID21, EAF3, EAF5, EAF6 and YAF9 increased resistance to lactic acid. Depletion of the cell-wall mannoprotein Sed1p provided resistance to lactic acid, although the expression of SED1 was induced by exposure to lactic acid. Depletion of vacuolar membrane H+-ATPase and high-osmolarity glycerol mitogen-activated protein kinase proteins caused acid sensitivity. Moreover, our quantitative PCR showed that expression of PDR12 increased under acid shock response with lactic acid and decreased under acid adaptation with hydrochloric acid.

Keywords
  • lactic acid
  • acetic acid
  • DNA microarray
  • functional screening
  • stress

Introduction

Saccharomyces cerevisiae is used for making fermented foods such as breads and alcoholic drinks. Sourdough, which is used in traditional breadmaking, is a spontaneously fermented mixture of flour and water containing yeasts, lactic acid bacteria, or acetic acid bacteria (Ng et al., 1972; Foschino et al., 2004). The organic acids from these microorganisms decrease the pH in sourdough. Sake mash and shochu moromi also contain organic acids and have low pH values. Organic acids produced by their normal fermentation as well as by competing microorganisms frequently inhibit growth of S. cerevisiae. However, the S. cerevisiae used for sake making is more resistant to organic acids than competing bacteria or wild yeasts. In this report, the condition with organic acids and low pH, such as found in sourdough, sake mash, and shochu moromi, is termed the acidic condition.

Previous studies have examined how some organic acids inhibit the growth of microorganisms (Narendranath et al., 2001; Thomas et al., 2002). The genetic mechanism involved in organic acid inhibition of the growth of yeasts has been studied (Casal et al., 1996; Ludovico et al., 2001; Paiva et al., 2004). Some organic acids are used as energy sources by some microorganisms. In S. cerevisiae cultures that are low in fermentable sugars, acetic acid and lactic acid are taken up from the medium and metabolized to acetyl-coenzyme A (CoA), which enters the TCA and glyoxylate cycles to fulfil the needs for energy and biosynthetic metabolites (Casal et al., 1996; Flores et al., 2000). However, a high concentration of organic acids is stressful. Organic acid stress is not simply owing to the toxic effect of a high hydrogen ion concentration, but is also dependent on the chemical nature of the organic acid to which the organism is exposed (Bayrock & Ingledew et al., 2004). Organic acids exert stronger inhibitory effects at low pH, where they are substantially undissociated.

Several studies have examined the effects of food preservatives, such as sorbic acid and benzoic acid, on S. cerevisiae (Holyoak et al., 1996, 1999; Piper et al., 1998, 2001; Bauer et al., 2003; Mollapour et al., 2004; Schuller et al., 2004). These studies have indicated the importance of the Pdr12 ATP-binding cassette transporter in the development of resistance to some weak acids. Growth of S. cerevisiae in the presence of such moderately lipophilic carboxylate preservatives is dependent on the induction of a specific stress response, involving the War1p transcription factor-dependent induction of Pdr12p (Schuller et al., 2004).

Citric acid also imposes a toxic effect on S. cerevisiae in high concentrations. A previous study (Lawrence et al., 2004) has indicated that the high-osmolarity glycerol mitogen-activated protein kinase (HOG MAPK) pathway regulates a unique stress response in S. cerevisiae upon exposure to citric acid. Citric acid does not induce osmotic stress, but it does induce a general stress response and glycerol biosynthesis. The inhibitory effects of citric acid are counteracted by a number of cellular proteins, including transcription factors mediating glucose depression, enzymes involved in amino acid biosynthesis, calcium transport channels, and the vacuolar membrane H+-ATPase (V-ATPase).

Microorganisms are able to adapt quickly to acidic environments such as those encountered in the mammalian stomach, whose low pH is due to hydrochloric acid (Tucker et al., 2002; Wen et al., 2003). In this report, the rapid response to an acidic environment by lactic acid, acetic acid or hydrochloric acid is termed the ‘acid shock response’ and is considered as the first step to adapt to an acidic condition. Microorganisms in fermented foods such as sourdough are affected by acids in the long term, which we call ‘acid adaptation’ and consider to be the result of maintaining integrity in the acidic condition.

The study of the yeast response to organic acids and low pH is important in the food industry. Moreover, S. cerevisiae is useful for studying the general response of eukaryotes to organic acids. We describe the genes involved in the organic acid response of S. cerevisiae using lactic acid and acetic acid. Hydrochloric acid was used as a low-pH control. To characterize the genes involved in the response to the acidic condition, we screened by two types of genome-wide analysis. One is an expression change using DNA microarrays, and the other a functional screening using the nonessential genes deletion collection of S. cerevisiae.

Materials and methods

Strains and media

Saccharomyces cerevisiae S288C was used for the expression analysis using DNA microarrays. Saccharomyces cerevisiae BY4742 was a parent strain of the nonessential genes deletion collection (openbiosystems), which contains 4908 yeast strains with all nonessential ORFs disrupted by the kanMX4 cassette (http://www-sequence.stanford.edu/group/yeast_deletion_project/deletions3.html). Yeast green fluorescent protein (GFP) clone ID YGL071W (Invitrogen, Carlsbad, CA) was used for visualizing Aft1p. YNB medium (0.67% yeast nitrogen base without amino acids, 2% glucose) was used for DNA microarrays, and SC Amino Acid Mixture (BIO 101 Systems, Irvine, CA) was added to YNB medium for yeast GFP clones. Yeast cells were grown in YPD medium (2% glucose, 1% yeast extract, 2% Bacto-peptone).

Gene expression analysis

The acid concentrations to be used in the DNA microarray analysis were determined so that the time of growth from OD660=0.5 to 1.0 was double that for the untreated culture. For the study of acid shock response, cells were grown to early-log phase (OD660=1.0) in YNB and then l-lactic acid 0.3% (weight in volume, w/v), acetic acid 0.3% (w/v) or hydrochloric acid 0.03% (w/v) were added to the cultures. The corresponding pH values of the media were 2.8, 3.3 and 2.6, respectively. Then, the cells were incubated at 30°C for 30 min. For the study of acid adaptation, cells from overnight cultures in YNB were suspended in fresh YNB with l-lactic acid 0.3% (w/v), acetic acid 0.3% (w/v) or hydrochloric acid 0.03% (w/v) to OD660=0.1 (the corresponding pH values of cultures were 2.8, 3.2 and 2.5, respectively) and grown at 30°C until an OD660 of 0.95–1.05 was reached. Cells were collected and centrifuged at 2000 g for 5 min, then washed twice with distilled water and stored at −80°C until RNA preparation. Total RNA was collected by the hot-phenol method (Kohrer & Domdey et al., 1991) and then labelled with Cy5-dCTP or Cy3-dCTP. Yeast chip v. 2.0 (DNA Chip Research, Yokohama, Japan) was used according to the manufacturer's instructions. Arrays were scanned using a commercially available scanning laser microscope (Fla 8000, Fuji Photo Film, Tokyo, Japan) and analysed using ArrayGuage v. 2.0 (Fuji Photo Film). The data obtained from four independent hybridizations per each condition were normalized using GeneSpring v. 6.2.1 (Silicon Genetics, Palo Alto, CA) and then analysed by FunCat (MIPS, Neuherberg, Germany) and GO Term Finder (SGD, Stanford, CA). The data were mathematically transformed subsequent to clustering analysis by dividing the expression ratios for each gene measured on a given array by the corresponding ratios measured for the cells grown in YNB. The data were graphically displayed in tabular format in which each row of coloured boxes represents the variation in transcript abundance for each gene and each column represents the variation in transcript levels of every gene in a given mRNA sample. The variations in transcript abundance for each gene were depicted by means of a colour scale, in which shades of red represent increases and shades of green represent decreases in mRNA levels, relative to the untreated culture, and the saturation of the colour corresponds to the magnitude of the differences. A dendrogram constructed during the clustering process depicted the relationships between genes: the branch lengths represented the degree of similarity between genes based on their expression profiles.

Functional screening using the nonessential genes deletion collection

The acid concentrations added to the media for selection were determined by a preliminary spotting experiment. Different amounts of BY4742 cells (106, 104 and 102 cells) were spotted on media containing various acid concentrations and incubated for 72 h at 30°C.

The acid concentrations and pH values of the solid media for the functional screening were as follows: l-lactic acid 3.1% (w/v) (for sensitivity, pH 2.9) and 5.1% (w/v) (for resistance, pH 2.7), acetic acid 0.4% (w/v) (for sensitivity, pH 4.3) and 0.5% (w/v) (for resistance, pH 4.2), or hydrochloric acid 0.24% (w/v) (for sensitivity, pH 2.6) and 0.28% (w/v) (for resistance, pH 2.4) was added to YPD medium after autoclaving. Mutant strains were transferred to standard 96-well microtitre plates. These plates replicated screening media after incubation for 3 days at 30°C. The growth of strains on screening media was confirmed visually after 3 days at 30°C. The data were analysed by FunCat (MIPS) and GO Term Finder (SGD).

Quantitative PCR

Total RNA was collected as described above for the DNA microarray analysis, and reverse-transcribed with an ExScript RT reagent Kit (Takara Bio, Otsu, Shiga, Japan). Primers were designed to yield an 87-bp product for AFT1 (CCATTCCAACAGCTACAATCCC and CATTACTGTTAGTGGGCAATACGAC), a 125-bp product for PDR12 (CACATATGCCACCAAAGTCGGTAA and TTGTGGCGTTATCCCAAGAGTAG) and a 110-bp product for ACT1 (as a control; ACTTACAACTCCATCATGAAGTGTG and TGCATTCTTTCGGCAATACCTG). Quantitative PCR was performed with qPCR Master Mix Plus for SYBR Green (Eurogenetec, Seraing, Belgium) by GeneAmp5700 Sequence Detection System (Applied Biosystems, Foster City, CA) according to the manufacturer's instructions. DNA was amplified with an initial 2-min incubation at 50°C and 10-min incubation at 95°C followed by 40 cycles of 15 s at 95°C and 1 min at 60°C.

GFP microscopy

Yeast GFP clone ID YGL071W was used for visualizing Aft1p. Cells were cultured under the same conditions as the acid adaptation conditions of the DNA microarray analysis. DNA was counterstained with 4′,6-diamidino-2-phenylindole, dihydrochloride (DAPI). Fluorescence of cells was visualized on an ECLIPSE E600 microscope (Nikon, Tokyo, Japan) using the appropriate filter set.

Results

Gene expression analysis and clustering analysis

For studying S. cerevisiae response to the acidic condition, we performed DNA microarray analysis using lactic acid and acetic acid, in addition to hydrochloric acid as a low-pH control. Those genes whose expression level changed as compared with acid-absent media are detailed in Tables S1–S4 (lactic acid), Tables S5–S8 (acetic acid), Tables S9–S12 (hydrochloric acid), Tables S1, S3, S5, S7, S9 and S11 (induced), Tables S2, S4, S6, S8, S10 and S12 (repressed), Tables S1, S2, S5, S6, S9 and S10 (acid shock) and Tables S3, S4, S7, S8, S11 and S12 (acid adaptation). Genes involved in stress response such as YGP1, TPS1 and HSP150 were induced under the acid shock conditions (Tables S1, S5 and S9, and Fig. 1). Genes involved in metal metabolism such as FIT2, ARN1 and ARN2 were induced under the acid adaptation conditions (Tables S3, S7 and S11, and Fig. 1). Moreover, the genes involved in stress response such as YGP1, DAK2 and HSP26 were induced in the presence of acetic acid even under the acid adaptation condition (Table S7). Genes involved in nitrogen metabolism such as ASP3, DAL5 and ATO3 were repressed under all conditions (Tables S2, S4, S6, S8, S10 and S12).

1

The expression profiles of 277 genes whose expression levels changed in at least one condition. The tree is connected from the bottom column to the top of the next column and so on. (a–c) Acid shock, (d–f) acid adaptation. (a) and (d) are with lactic acid, (b) and (e) are with acetic acid, and (c) and (f) are with hydrochloric acid. Each horizontal strip represents a single gene, whose name is indicated on the right. The fold change is represented by colour indicated on the colour bar. Genes in bold typeface are localized or organized on the cell wall. Genes that are underlined are involved in metal metabolism.

Figure 1 shows a clustering analysis of the genes whose expression level changed under at least one of the six conditions. The 277 genes whose expression changed included many plasma membrane proteins, such as the transporters. Although some amino acid transporters were repressed under all conditions, some metal transporters and hexose transporters were induced at least under acid adaptation conditions.

Genes involved in metal homeostasis such as ARN1, CCC2, FIT1-3, CUP1 and SIT1 were also induced at least under acid adaptation conditions. Most of these genes were regulated by Aft1p, a transcription factor that responds to intracellular iron (Yamaguchi-Iwai et al., 1996; Rutherford et al., 2003). Most of Aft1p-regulated genes (FRE1-3, FRE5, FIT1-3, COT1, SIT1 and FET3) were in the same cluster; they did not change significantly under acid shock but were induced under acid adaptation. The regulation of Aft1p is associated with mitochondrial Fe–S cluster and iron concentration (Chen et al., 2004; Phadnis & Ayres Sia et al., 2004). LEU1 and ACO1, which encode Fe–S cluster proteins (Puig et al., 2005), decreased expression under all conditions (Fig. 1). A cell-wall protein encoded by SED1 and an uncharacterized protein encoded by VMR1, which are also regulated by Aft1p (Rutherford et al., 2003), were induced under all conditions (Fig. 1).

Sed1p is known as a cell-wall mannoprotein, which is highly expressed in the stationary phase (Shimoi et al., 1998). The genes encoding cell-wall components such as SCW10, HSP150 and CRH1 were induced under all conditions. We found that yeast cell aggregation was observed under the acidic conditions (data not shown). These aspects suggest that the acidic condition induced changes in cell-wall architecture.

Expression change of AFT1 and localization of Aft1p under the acid adaptation condition

DNA microarray analysis suggested that the acidic condition affects metal metabolism regulated by Aft1p in yeast. Because AFT1 is not one of the genes on the DNA microarray chip, we measured its expression change with quantitative PCR. AFT1 was found to be induced under acid shock response (2.3-fold for lactic acid, 3.5-fold for acetic acid, 1.8-fold for hydrochloric acid), and 2.5-fold under acid adaptation by lactic acid. A previous study (Yamaguchi-Iwai et al., 2002) had shown that iron-regulated expression of the target genes by Aft1p is due to the transport of Aft1p into the nucleus, rather than to the change in the total expression level of Aft1p. Therefore, we examined the subcellular localization of GFP-fused Aft1p (Fig. 2). We observed that GFP-fused Aft1p was localized to the nucleus in cells grown in media containing lactic acid, acetic acid or hydrochloric acid. By contrast, GFP-fused Aft1p was not localized to the nucleus in cells grown in YNB medium. These results indicated that the nuclear localization of Aft1p is important under the acidic condition.

2

Localization of green fluorescent protein-fused Aft1p. Cells were grown in media containing lactic acid, acetic acid or hydrochloric acid at 30°C until an OD660 of 0.95–1.05 was reached. DNA was counterstained with 4′,6-diamidino-2-phenylindole, dihydrochloride (DAPI). Fluorescence of cells was visualized on an ECLIPSE E600 microscope (Nikon) by using the appropriate filter set. DIC, differential interference contrast microscopy.

A functional screening using the nonessential genes deletion collection

Functional screening was used to identify important genes under the acidic condition. The minimal inhibitory concentrations (w/v) of lactic acid, acetic acid and hydrochloric acid were 5.1, 0.5 and 0.3%, respectively (Fig. 3). The corresponding pH values were 2.7, 4.2 and 2.3.

3

Growth of Saccharomyces cerevisiae BY4742 is inhibited in the presence of acids. (a) Yeast cells were spotted onto YPD medium to give 106, 104 and 102 cells per spot. Plates were incubated for 72 h at 30°C before the plates were photographed. (b) Yeast cells were spotted onto YPD media with lactic acid at the indicated concentration (w/v). The cell number and culture condition were the same as in (a). The same tests were carried out with: (c) acetic acid and (d) hydrochloric acid. The pH values of media were: YPD (pH 6.1); YPD with lactic acid 2.1% (pH 3.1), 4.2% (pH 2.7) and 5.1% (pH 2.7); YPD with acetic acid 0.3% (pH 4.4), 0.4% (pH 4.3) and 0.5% (pH 4.2); YPD with hydrochloric acid 0.26% (pH 2.5), 0.28% (pH 2.4) and 0.30% (pH 2.3).

Of 4908 yeast deletion strains, approximately 1% showed resistance and approximately 3–5% showed sensitivity to each acid. The deletion strains showing increased resistance to the organic acids and low pH by hydrochloric acid are indicated in Table 1. Although in the deletion strains identified by our functional analysis diverse cellular functions were involved with acetic acid and hydrochloric acid, the depletion of cell-wall components encoded by SED1, DSE2, CTS1, EGT2, SCW11, SUN4 and YNL300W and histone acetyltransferase complex proteins encoded by YID21, EAF3, EAF5, EAF6 and YAF9 increased resistance to lactic acid media (Table 1). Depletion of the cell-wall mannoprotein encoded by SED1 provided resistance to lactic acid, although the expression of SED1 was induced by exposure to lactic acid. Therefore, the genes involved in cell-wall component genes were identified as important for response to organic acids and low pH, especially lactic acid, as indicated by both the expression analysis and the functional analysis.

View this table:
1

Resistance to acids

ORF nameGeneLactic acidAcetic acidHydrochloric acidORF nameGeneLactic acidAcetic acidHydrochloric acid
Cell wall Other function
YLR286CCTS1+YLR131CACE2++
YHR143WDSE2+YPL078CATP4+++
YNL327WEGT2+++YJR092WBUD4+
YGL028CSCW11++YML012WERV25+
YDR077WSED1+YGL080WFMP37+
YNL300W++YAL034CFUN19+
Histone acetyltransferaseYAL031CFUN21+
YPR023CEAF3++YLL060CGTT2+
YEL018WEAF5+YNL215WIES2+
YJR082CEAF6+YNL265CIST1++
YDR359CVID21+YPL135WISU1+
YNL107WYAF9+YPR138CMEP3+
Vacuolar transportYPL226WNEW1++
YCL038CATG22+YDL046WNPC2++
YBR131WCCZ1++YPL159CPET20+
YHL002WHSE1+YOL136CPFK27+
YLR119WSRN2++YMR302CPRP12++
YAL014CSYN8++YMR063WRIM9+
YGL212WVAM7+YIL018WRPL2B+
YGL104CVPS73+YLR325CRPL38++
YPL019CVTC3+YML073CRPL6A+
YML001WYPT7+YBL103CRTG3+
Protein fateYMR305CSCW10++
YBR170CNPL4+YPL047WSGF11+++
YCR008WSAT4+YMR140WSIP5++
YDL134CPPH21+YKR072CSIS2+
YDL137WARF2+YJL151CSNA3++
YDR092WUBC13+++YBR194WSOY1++
YEL053CMAK10+YDL048CSTP4++
YER005WYND1+YDR346CSVF1++
YER120WSCS2+YDR058CTGL2+
YGR270WYTA7+YHL009CYAP3+
YGR285CZUO1+YBR111CYSA1++
YJL168CSET2+YJR127CZMS1+
YJL186WMNN5++YAL045C+
YJR075WHOC1+YCL062W+
YKL126WYPK1++YDR360W+
YML013WSEL1++YDR509W+
YMR154CRIM13+YEL043W++
YMR275CBUL1+YER113C+
YNR032WPPG1+YFR044C+
YNR069CBSC5++YGL177W+
Biogenesis of cellular componentsYGR206W++
YAL051WOAF1+YIL110W+
YCL063WVAC17+YJL051W++
YDL225WSHS1+YJL182C+
YDL240WLRG1+YJL206C+
YGL200CEMP24+YLR111W+
YIL146CECM37+YLR346C++
YNL066WSUN4+YML082W+
YPL246CRBD2+YML084W+
YDR227WSIR4+YMR294W-a+
Cell fateYMR310C++
YER124CDSE1+YOL070C+
YNL325CFIG4+YOR240W+
YOR083WWHI5+YOR289W+
YPL176C+
YPL191C++
YPL194W++
  • A plus sign indicates that the gene deletion strain has a resistance to the acid.

Proteins encoded by VMA2, VMA4, and VMA6, whose depletion causes sensitivity to all acids, were hydrogen-translocating V-ATPase complex proteins localized in the vacuole (Table 2). These findings suggest that the vacuole is essential for growth on organic acid media and at low pH. Depletion of the hyperosmolarity response proteins encoded by HOG1, PBS2, SSK1 and SSK2, which are in the HOG MAPK pathway, also resulted in acid sensitivity (Table 2). This result agrees with a study of the citric acid response of S. cerevisiae (Lawrence et al., 2004).

View this table:
2

Sensitivity to acids

ORF nameGeneLactic acidAcetic acidHydrochloric acidORF nameGeneLactic acidAcetic acidHydrochloric acid
Cellular transport, transport facilitation and transport routes
Vacuolar transport Vesicular transport (Golgi network etc.)
YBR164CARL1YFL025CBST1
YBR290WBSD2YNL051WCOG5
YGL206CCHC1YAL026CDRS2
YGR167WCLC1YGL054CERV14
YEL027WCUP5YGR166WKRE11
YKL002WDID4YJL053WPEP8
YCR034WFEN1YKL212WSAC1
YOR070CGYP1YIL076WSEC28
YKL176CLST4YMR183CSSO2
YNL297CMON2YLR372WSUR4
YDR456WNHX1YOR132WVPS17
YLR148WPEP3YOR069WVPS5
YMR231WPEP5YNL064CYDJ1
YDR323CPEP7YLR262CYPT6
YLR025WSNF7Ion transport
YDL185WTFP1YJR121WATP2
YPL234CTFP3YMR038CCCS1
YOL018CTLG2YLL027WISA1
YPR036WVMA13YNL291CMID1
YBR127CVMA2YEL017C–APMP2
YOR332WVMA4YHR026WPPA1
YKL080WVMA5YJL129CTRK1
YLR447CVMA6Other
YGR020CVMA7YGL148WARO2
YEL051WVMA8YBR068CBAP2
YKR001CVPS1YBR021WFUR4
YBR097WVPS15YGL084CGUP1
YPL045WVPS16YDR138WHPR1
YMR077CVPS20YKL073WLHS1
YOR089CVPS21YDR432WNPL3
YKL041WVPS24YMR091CNPL6
YJR102CVPS25YBL079WNUP170
YHR012WVPS29YPL148CPPT2
YDR495CVPS3YJL204CRCY1
YLR240WVPS34YDR137WRGP1
YJL154CVPS35YLR039CRIC1
YLR417WVPS36YOL072WTHP1
YGL095CVPS45YCR053WTHR4
YKR020WVPS51YPR156CTPO3
YPR139CVPS66YLR337CVRP1
YML097CVPS9
YDR136C
Protein fate (folding, modification, destination)
Protein modification
YPL227CALG5YGL194CHOS2
YOR002WALG6YKL101WHSL1
YOR067CALG8YGL203CKEX1
YEL036CANP1YNL307CMCK1
YBR128CATG14YOL076WMDM20
YLR423CATG17YJL183WMNN11
YJL095WBCK1YDR140WMTQ2
YGR262CBUD32YGL038COCH1
YGR036CCAX4YDL232WOST4
YKL190WCNB1YGL058WRAD6
YKL139WCTK1YBL082CRHK1
YML112WCTK3YMR214WSCJ1
YGR227WDIE2YDL047WSIT4
YJL184WGON7YOL113WSKM1
YPL254WHFI1YCR033WSNT1
YJR075WHOC1YJL127CSPT10
YOL148CSPT20YMR304WUBP15
YDR392WSPT3YML115CVAN1
YAL016WTPD3YLR020CYEH2
Interaction with the cellular environment
Osmosensing Cellular sensing and response
YLR113WHOG1YDL100CARR4
YBR260CRGD1YPL161CBEM4
YJL128CPBS2YCR002CCDC10
YHR030CSLT2YOL051WGAL11
YLR006CSSK1YER068WMOT2
YNR031CSSK2YBR289WSNF5
Ionic homeostasisYHL025WSNF6
YBR036CCSG2YJL176CSWI3
YKR007WMEH1YPL129WTAF14
YKL040CNFU1
YCR044CPER1
YPL188WPOS5
YJR104CSOD1
YKL119CVPH2
Metabolism
Amino acid metabolism C-compound and carbohydrate metabolism
YDR173CARG82YER155CBEM2
YDR127WARO1YOR299WBUD7
YAL021CCCR4YGL027CCWH41
YIR023WDAL81YLR342WFKS1
YAL044CGCV3YPL262WFUM1
YEL046CGLY1YMR307WGAS1
YDR158WHOM2YHR183WGND1
YER052CHOM3YNL322CKRE1
YER086WILV1YPR159WKRE6
YLR451WLEU3YGL035CMIG1
YFL018CLPD1YGR240CPFK1
YIL128WMET18YMR205CPFK2
YOR323CPRO2YNR052CPOP2
YHL011CPRS3YBR229CROT2
YHR025WTHR1YJL121CRPE1
YDR007WTRP1YGR229CSMI1
YGL026CTRP5YPL057CSUR1
YBR166CTYR1YBR126CTPS1
YNL241CZWF1YDR074WTPS2
Lipid, fatty acid and isoprenoid metabolism
YMR202WERG2
YNL280CERG24
YER044CERG28
YLR056WERG3
YGL012WERG4
YMR015CERG5
YML008CERG6
YBR026CETR1
YMR207CHFA1
YHR067WHTD2
YDR017CKCS1
YKL055COAR1
YBR035CPDX3
YBR058C-ATSC3
Other function
YOR092WECM3YOR001WRRP6
YNL148CALF1YJL080CSCP160
YMR116CASC1YOR035CSHE4
YLR399CBDF1YNL032WSIW14
YPL221WBOP1YMR216CSKY1
YEL029CBUD16YNL243WSLA2
YCR047CBUD23YBL058WSHP1
YER014C-ABUD25YNR023WSNF12
YLR226WBUR2YAL047CSPC72
YGR217WCCH1YOL091WSPO21
YDR364CCDC40YGR063CSPT4
YLR418CCDC73YNL138WSRV2
YLR087CCSF1YDR293CSSD1
YKL046CDCW1YHR064CSSZ1
YKL054CDEF1YMR125WSTO1
YDL160CDHH1YMR039CSUB1
YEL018WEAF5YLR182WSWI6
YKL204WEAP1YPR163CTIF3
YLR436CECM30YOR295WUAF30
YLR443WECM7YOR068CVAM10
YNL133CFYV6YDR359CVID21
YGR196CFYV8YGR105WVMA21
YGR163WGTR2YNL197CWHI3
YER057CHMF1YCL002C
YMR032WHOF1YCR079W
YJL159WHSP150YDL173W
YCR020W-BHTL1YEL007W
YOL012CHTZ1YGL007C-A
YGL168WHUR1YGL188C-A
YJL077CICS3YJL046W
YEL044WIES6YKL077W
YOL081WIRA2YKR041W
YPL213WLEA1YOL111C
YNL323WLEM3YOR322C
YOR196CLIP5YPL144W
YJL124CLSM1YBL083C
YDR378CLSM6YCL007C
YKL143WLTV1YDL096C
YFL016CMDJ1YDL118W
YGL143CMRF1YDL172C
YDR162CNBP2YDR008C
YBR279WPAF1YDR360W
YCR077CPAT1YDR417C
YBR221CPDB1YDR433W
YGL025CPGD1YDR442W
YOR265WRBL2YEL045C
YDR195WREF2YEL059W
YOL143CRIB4YGL007W
YPL089CRLM1YGL024W
YER083CRMD7YGL042C
YER070WRNR1YGR064W
YPL123CRNY1YHR039C–B
YBL093CROX3YJL120W
YJL140WRPB4YJL175W
YGL070CRPB9YLR261C
YMR142CRPL13BYLR322W
YGL135WRPL1BYML095C–A
YOR312CRPL20BYNL296W
YBR191WRPL21AYOR331C
YIL052CRPL34BYPR090W
YDL081CRPP1AYPR123C
YBL025WRRN10
  • A dash indicates that the gene deletion strain has a sensitivity to the acid.

Discussion

The expression analysis and the functional screening both suggested that the acidic condition affects cell-wall architecture, which might indicate that expression change of cell-wall-related genes under the acidic conditions results in a change of cell-wall architecture. The expression analysis indicated that most of the genes involved in metal metabolism regulated by Aft1p were induced at least under the acid adaptation conditions. The functional screening indicated that loss of the V-ATPase and HOG MAPK proteins caused acid sensitivity.

The microarray results indicated that the expression levels of several genes regulated by transcription factors Aft1p and Aft2p (Blaiseau et al., 2001; Rutherford et al., 2003) changed at least under the acid adaptation conditions. These genes encode iron reductases (FRE1-3, FRE5) (Georgatsou & Alexandraki et al., 1999), iron permease (FTR1), siderophore transporter (ARN1 and 2) (Kim et al., 2005), ferroxidase (FET3) (Askwith et al., 1994) and siderophore uptake-related proteins (FIT1FIT3) (Protchenko et al., 2001). These results suggest that the acidic condition affects metal metabolism in yeast. AFT1 was found to be induced under acid shock and under acid adaptation by lactic acid. Moreover, we observed that GFP-fused Aft1p was localized to the nucleus in cells grown in media containing lactic acid, acetic acid and hydrochloric acid. The nuclear localization of Aft1p is important under acidic conditions just as in the iron-depleted condition. There are two explanations for why the expression of AFT1 and the genes regulated by Aft1p are changed and Aft1p is localized to the nucleus: (1) yeast is not able to import iron from the media, and (2) yeast needs iron more under the acidic condition. Strains of S. cerevisiae lacking an iron transporter gene cannot grow under alkali stress conditions (Serrano et al., 2004; Viladevall et al., 2004). Several genes whose absence results in reduced growth at mild alkaline pH include several key genes in iron and copper homeostasis, such as CCC2, AFT1, FET3, LYS7 and CTR1 (Dancis et al., 1994). Strains with increased copy numbers of FET4 and CTR1 have increased resistance to alkaline pH (Serrano et al., 2004). Therefore, the extracellular pH change, either acidic or mildly alkaline, affects iron metabolism, although none of the strains lacking iron metabolism genes showed resistance or sensitivity to acids. Recent studies have shown that activation of Aft1p is not a direct response to cytosolic iron, but activation of the iron regulon was controlled by the synthesis of Fe–S clusters, which in yeast are localized within mitochondria (Chen et al., 2004; Phadnis & Ayres Sia et al., 2004). The results of the present study suggest that the expression of Fe–S cluster proteins encoded by LEU1 and ACO1 (Puig et al., 2005) decreased under acidic conditions (Fig. 1). Moreover, other studies have shown that Aft1p is involved in the diauxic shift (Haurie et al., 2003) and oxidative stress (Park et al., 2005). As the function of Aft1p is diverse, further studies are needed to understand why the expression of genes involved in metal metabolism is induced and why Aft1p is localized to the nucleus under acidic conditions just as under iron depletion.

The expression of SED1, which encodes a cell-wall mannoprotein that is highly expressed in the stationary phase (Shimoi et al., 1998), is also regulated by Aft1p (Park et al., 2005). Our study shows that the expression of SED1 is induced under the acidic conditions (Fig. 1), although the deletion of SED1 results in acid resistance (Table 1). These results suggest that the acidic condition affects cell-wall architecture. In fact, low pH has been found to induce alterations in yeast cell-wall architecture (Kapteyn et al., 2001). Moreover, a recent study has shown that Sed1p is involved in maintenance of the mitochondrial genome such that several modified forms of Sed1p are expressed and the largest of these forms interacts with the mitochondrial polymerase in vitro (Phadnis & Ayres Sia et al., 2004). Further investigation is required to resolve why expression of SED1 was induced under the acidic conditions and why the depletion of Sed1p caused acid resistance.

V-ATPase-depleting mutants exhibited sensitivity to the acids (Table 2), indicating that this enzyme is critically important for acid resistance. V-ATPase multisubunit complexes are present in all eukaryotic cells and are required for a range of cellular processes, including receptor-mediated endocytosis, renal acidification, bone reabsorption, neurotransmitter accumulation and activation of acid hydrolases (Holyoak et al., 1996; Graham et al., 2000). V-ATPase maintains the acidity of the vacuole and generates the electrogenic potential that is used to drive the accumulation of ions and small molecules, amino acids and metabolites. The sensitivity caused by V-ATPase depletion was observed with all acids used in this study. Moreover, mutants with defective V-ATPase were found to be markedly sorbate-sensitive (Mollapour et al., 2004). Therefore, the acid sensitivity caused by V-ATPase depletion under the acidic conditions is not due to sensitivity to a particular acid.

The deletion of genes in the HOG MAPK pathway, such as HOG1, PBS2, SSK1 and SSK2, results in sensitivity to acids, including hydrochloric acid (Table 2). The HOG MAPK pathway was found to have an important role in the regulation of adaptation to citric acid stress (Lawrence et al., 2004). These findings suggest that sensitivity to acids caused by the deletion of genes in the HOG MAPK pathway is due to the low pH, rather than to the chemical nature of the acid.

Jen1p is a known transporter of lactic acid and Ady2p is predicted to be an acetic acid transporter (Casal et al., 1996, 1999; Akita et al., 2000; Paiva et al., 2004). Acidic conditions induced the expression of JEN1 (Fig. 1) but not of ADY2. These gene deletion strains were not resistant or sensitive to acids in this study. MCH1-5 and YHL008C encode the monocarboxylate permeases, homologues to mammalian monocarboxylate permeases, which are not involved in the uptake or secretion of monocarboxylates (Makuc et al., 2001). That study showed that transcription of MCH5 was induced by lactic acid, just as our DNA microarray experiment showed 2.75-fold induction by lactic acid under acid adaptation. Pdr12p (which is not on the DNA microarray chip) is needed to develop resistance to some weak acids such as sorbic acid (Schuller et al., 2004). Our quantitative PCR analysis showed that expression of PDR12 increased 3.9-fold under the acid shock response with lactic acid and decreased 5.0-fold under the acid adaptation with hydrochloric acid, whereas the PDR12 deletion strain was not sensitive to acids in this study. In addition, several gene deletion strains lacking various vacuolar sorting proteins were sensitive to acids. The vacuolar sorting protein mutants exhibit general stress sensitivity (Shimoni & Schekman et al., 2002).

Finally, the expression analysis and the functional screening both suggested that the acidic condition affects cell-wall architecture. The expression analysis suggested that the acidic condition affects metal metabolism in yeast. The functional screening indicated that loss of the V-ATPase and HOG MAPK proteins caused acid sensitivity.

Supplementary material

Table S1. Yeast genes induced more than 2.0-fold due to exposure to 0.3 % (w/v) lactic acid for 30 min.

Table S2. Yeast genes repressed less than 0.5-fold due to exposure to 0.3 % (w/v) lactic acid for 30 min.

Table S3. Yeast genes induced more than 2.0-fold due to exposure to 0.3 % (w/v) lactic acid for growth from OD660=0.1 to OD660=1.0.

Table S4. Yeast genes repressed less than 0.5-fold due to exposure to 0.3 % (w/v) lactic acid for growth from OD660=0.1 to OD660=1.0.

Table S5. Yeast genes induced more than 3.0-fold due to exposure to 0.3 % (w/v) acetic acid for 30 min.

Table S6. Yeast genes repressed less than 0.5-fold due to exposure to 0.3 % (w/v) acetic acid for 30min.

Table S7. Yeast genes induced more than 2.5-fold due to exposure to 0.3 % (w/v) acetic acid for growth from OD660=0.1 to OD660=1.0.

Table S8. Yeast genes repressed less than 0.4-fold due to exposure to 0.3 % (w/v) acetic acid for growth from OD660=0.1 to OD660=1.0.

Table S9. Yeast genes induced more than 3.5-fold due to exposure to 0.03 % (w/v) hydrochloric acid for 30 min.

Table S10. Yeast genes repressed less than 0.4-fold due to exposure to 0.03 % (w/v) hydrochloric acid for 30 min.

Table S11. Yeast genes induced more than 6.0-fold due to exposure to 0.03 % (w/v) hydrochloric acid for growth from OD660=0.1 to OD660=1.0.

Table S12. Yeast genes repressed less than 0.3-fold due to exposure to 0.03 % (w/v) hydrochloric acid for growth from OD660=0.1 to OD660=1.0.

Footnotes

  • Editor: Lex Scheffers

References

View Abstract