OUP user menu

The expressions of Δ9-, Δ12-desaturases and an elongase by the extremely halotolerant black yeast Hortaea werneckii are salt dependent

Cene Gostinčar, Martina Turk, Ana Plemenitaš, Nina Gunde-Cimerman
DOI: http://dx.doi.org/10.1111/j.1567-1364.2009.00481.x 247-256 First published online: 1 March 2009

Abstract

The black yeast-like fungus Hortaea werneckii is the predominant fungal species in salterns, and it is extremely halotolerant. The restructuring of the H. werneckii membrane lipid composition is one of its adaptations to high concentrations of salt, which is mainly achieved by increasing the unsaturation of its phospholipid fatty acids. Genes encoding three fatty acid-modifying enzymes, Δ9-, Δ12-desaturases and an elongase, have been identified in the genome of H. werneckii, each in two copies. Their transcription profiles show responsiveness to different salinity conditions, with the lowest expression at optimal salinity. Transcriptional responses to hyperosmotic and hypo-osmotic shock show substantial differences between cells exposed to osmotic shock and cells adapted to an osmotically stressful environment.

Keywords
  • Hortaea werneckii
  • extremotolerance
  • halotolerance
  • desaturase
  • elongase
  • salt stress

Introduction

The survival of most microorganisms in nature depends on their ability to adapt to life under different osmotic conditions and to sudden changes in osmotic pressure. To date, studies on hyperosmotic adaptation and salt tolerance in fungal species have been mainly performed on the salt-sensitive Saccharomyces cerevisiae (Rep, 2000; Yale & Bohnert, 2001). However, neither the ecology nor the metabolism of S. cerevisiae are adapted to environments with extremely low water activities and toxic concentrations of ions. On the other hand, extremely halotolerant and halophilic fungi that inhabit hypersaline waters in salterns or very salty food have unique mechanisms that enable them to survive in these environments. The extremely halotolerant Hortaea werneckii (Dothideales, Ascomycota) is the dominant species among these (Zalar, 1999). It is a melanized yeast-like fungus, which was previously known primarily to be the causative agent of a mild and noninvasive human skin infection, known as tinea nigra, and it has only recently been linked with solar salterns as its natural ecological niche (Gunde-Cimerman, 2000).

Many physiological and molecular mechanisms that enable H. werneckii to survive under such extreme conditions have been revealed over the last 6 years or so (Petrovič, 2002; Turk & Plemenitaš, 2002; Kogej, 2005, 2007; Gorjan & Plemenitaš, 2006; Lenassi & Plemenitaš, 2007; Lenassi, 2007; Vaupotič, 2007, 2008a, b; Vaupotič & Plemenitaš, 2007a, b). Changes in cellular membranes are among adaptations to hypersalinity that differ from responses previously seen in the salt-sensitive S. cerevisiae. In H. werneckii, besides changes in the sterol-to-phospholipid ratio, salt stress induces an increase in the unsaturated fatty acids and their length, resulting in higher plasma membrane fluidity over a wide range of NaCl concentrations (Turk, 2004, 2007).

Such adaptations have been previously suggested to increase membrane fluidity at high salt concentrations (Russell, 1989), a mechanism seen in cells subjected to low temperatures. This is not an unexpected response, because different ions and other molecules in solution interact with lipid bilayers and alter their physical characteristics, such as their headgroup hydration or melting temperature. A careful balance of membrane fluidity is, on the other hand, essential for normal functioning of the cell (Hazel & Williams, 1990).

Some of these adaptations are enabled through the salt-regulated expression of genes involved in fatty acid modification. In the salt-sensitive S. cerevisiae and in the moderately halotolerant melanized yeast-like fungus Aureobasidium pullulans, the expression of genes encoding the Δ9-desaturase (OLE1), Δ12-desaturase (ODE12) and elongases (ELO1, ELO2 and ELO3) has been shown to be salt responsive (Gasch, 2000; Causton, 2001; Gostinčar, 2008). No such data have so far been reported for the extremely halotolerant H. werneckii, although we have previously shown that for the fatty acids in H. werneckii, increased salinity is accompanied by a decrease in palmitic acid (C16:0), together with an increase in linoleic acid (cis-C18:2Δ9,12) (Turk, 2004). Thus, the aim of the present study was to identify genes encoding desaturases and elongases in the genome of H. werneckii and to compare them with known homologues from other organisms. Additionally, in light of the changes in the membrane composition of H. werneckii at different salinities, their expression responses to different salinities and osmotic shocks were determined.

Materials and methods

Media, strains and growth conditions

The halophilic black yeast-like fungus H. werneckii (EXF-225 strain) was isolated from marine solar salterns on the Adriatic coast (Slovenia) (Gunde-Cimerman, 2000). It is maintained in the Ex Culture Collection of the Department of Biology, Biotechnical Faculty, University of Ljubljana (Slovenia), and as MZKI B-736 in the Microbial Culture Collection of the National Institute of Chemistry (Slovenia). It was cultivated using the standard yeast nitrogen base (YNB, Qbiogene, Heidelberg, Germany) chemically defined medium, both without NaCl and with different concentrations of added NaCl (5%, 10%, 13%, 17% and 25%; w/v). Liquid cultures were grown at 28 °C on a rotary shaker at 180 r.p.m.

DNA and RNA isolation

For DNA isolation, H. werneckii was grown in the YNB liquid medium and harvested by centrifugation in the mid-exponential growth phase (OD600 nm=0.8–1.0). The pellet was frozen in liquid nitrogen and homogenized using a mortar and pestle. The DNA was then isolated according to the protocol described by Rozman & Komel (1994).

For RNA isolation, H. werneckii was grown in the YNB liquid medium with different amounts of NaCl added, and harvested by centrifugation in the mid-exponential growth phase (OD600 nm=0.8–1.0). The cells were subjected to osmotic shock and grown in the liquid YNB medium without NaCl or with 17% NaCl (w/v). They were harvested by centrifugation and then resuspended in the medium with 17% NaCl (w/v) or medium without added salt, respectively. Aliquots of resuspended cells were again pelleted at different time intervals after the shock. Their RNA was isolated using TRI REAGENT (Sigma) according to the manufacturer's instructions. Possible DNA contaminations were degraded with DNAse I (Fermentas), and the integrity and purity of the RNA were evaluated spectrometrically and with formaldehyde agarose electrophoresis.

Identification of genes

Partial sequences of the genes encoding the Δ9- and Δ12-desaturases were amplified by PCR using 150 ng of DNA in a 10-μL PCR reaction, with 10 pmol of specific primers (Table 1, nos 1 and 2), 2.5 nmol of each dNTP, 15 nmol MgCl2 and 0.625 U of Taq polymerase (Fermentas). The thermal profile of the reaction was as follows: 5 min of denaturation at 94 °C, and for the Δ9-desaturase, this was followed by 25 cycles of 30 s at 94 °C, 30 s at 62 °C and 30 s at 72 °C, while for the Δ12-desaturase, the denaturation was followed by 30 cycles of 30 s at 94 °C, 30 s at 58 °C and 30 s at 72 °C. At the end of both these programs, 7.5 min of elongation followed. Nondegenerate oligonucleotide primers were constructed on the basis of highly conserved domains in known fungal desaturases retrieved from the GenBank database. Amplified fragments were recovered from the electrophoresis gels using Perfectprep Gel Cleanup (Eppendorf), and sequenced.

View this table:
1

The PCR primers used in the present study

NosAmpliconPrimer sequence (5′–3′)
1Partial sequence of the genes for Δ9-desaturaseTACACCGATACCGACAAGGACCCCTA
GGAACTCGTGGTGGAAGTTGTGGTA
2Partial sequence of the genes for Δ12-desaturaseCCATCAAGGAGATCCGTGATGCCAT
ATGTTACCAGTGGCCTTGTGGTGCT
3Partial sequence of the genes for elongaseGTCATCTACTACATCATCATHTTYGGNGG
GTCATCTACTACATCATCATHTTYGGNGG
4Partial sequence of the genes for elongaseTTCCTCGAGCTCCTCGATACCG
CTGCTCGTCCTTCATCTCGACCA
5Partial sequence of the Δ9-desaturase isogene ATGAGGTGGCAGACCGCTG
CGAGACCGCTGACCAAGCAA
6Partial sequence of the Δ9-desaturase isogene BACTGAGATGGCAGACTGCTC
AGACCACTGACGAGGCAG
7Partial sequence of the Δ12-desaturase isogene ACAAAACCAAAAAACACCCGCCCAC
GCGGCAGAGGAAGGGGAG
8Partial sequence of the Δ12-desaturase isogene BGCAGCAAAATCAAAACCAAAACCGCAC
CGGCAGCTGAAGAGGGCGA
9Partial sequence of the elongase isogene AGGAAGAAGTACATCACCATGC
GGGTCGCGGCGGAAG
10Partial sequence of the elongase isogene BGGAAGAAGTACATCACAATGC
TCGCGGCGGGC

The partial sequence for elongase was amplified by PCR from protein sequences of known fungal elongases retrieved using primers designed from the GenBank database using the CODEHOP algorithm (Rose, 1998). These can be found in Table 1 (no. 3). The composition of the reaction mix was the same as described above. For the amplification of the fragment, touchdown PCR was used, where the annealing temperature was decreased from 65 to 58 °C through 10 increments of 0.7 °C, and then the program continued for 20 cycles, each consisting of 30 s at 94 °C, 30 s at 58 °C and 30 s at 72 °C, followed by the final elongation step for 7.5 min. The amplified fragment was recovered from the gel using Perfectprep Gel Cleanup (Eppendorf), and then cloned into Escherichia coli using the pGEM®-T Vector System (Promega), and sequenced.

Southern blotting was performed as described previously (Turk & Plemenitaš, 2002). The DNA probes were amplified as described above. For elongase, nondegenerate primers were first constructed (Table 1, no. 4). Amplified fragments were radioactively labelled and used as probes.

Screening of genomic DNA and cDNA H. werneckii libraries as described previously (Turk & Plemenitaš, 2002), with the radioactively labelled probes obtained as described above, was used for determination of up- and downstream regions of the investigated genes. The upstream and downstream sequences of two Δ12-desaturase, one Δ9-desaturase, and one fatty acid elongase genes, the upstream sequence of another Δ9-desaturase and the downstream sequence of another fatty acid elongase genes were obtained. The fragments acquired were sequenced and assembled into complete gene sequences.

Gene phylogeny reconstruction

Analysis of gene phylogenies was performed as described previously (Gostinčar, 2008). In short, homologues of the Δ9-desaturase and Δ12-desaturase and the elongase were identified by blast searches (Altschul, 1997) against a GenBank nonredundant protein database. Protein sequences were aligned using clustalx (Thompson, 1997) and edited in the bioedit software (Hall, 1999). Gene trees were generated with mrbayes software, applying Bayesian inference (Huelsenbeck & Ronquist, 2001; Ronquist & Huelsenbeck, 2003). Runs were performed to two million generations with mixed amino acid models, the default temperature and six chains. The trees were sampled every 100 generations. Trees sampled before the analysis reached stationarity of likelihood values, and those sampled before the average SD of the split frequencies reduced below 1% were excluded from the final analysis. The stationarity of the likelihood values was checked using the tracer software (Rambaut & Drummond, 2007). Enzymes from Mortierella alpina were used as outgroups.

Real-time PCR

The RevertAid H Minus First Strand cDNA Synthesis Kit (Fermentas) was used to synthesize cDNA from total H. werneckii RNA. Approximately 100 ng of cDNA was then used as a template for real-time PCR with oligonucleotides specific for the genes under investigation. The primer sequences are given in Table 1 (nos 5–10). The thermal profile of the reaction was as follows: 2 min at 50 °C, 10 min at 95 °C, 40 cycles consisting of 30 s at 95 °C, 30 s at 59 °C and 30 s at 72 °C, followed by a dissociation curve. The reaction mix was prepared using the Power SYBR R Green PCR Master Mix (Applied Biosystems), according to the manufacturer's instructions. The reactions were performed in an ABI 7900 Real-Time PCR Instrument, and analysed with sequence detection systems 2.2.2 software (Applied Biosystems). Values for our genes of interest were standardized to the amount of the 28S rRNA gene fragment, whose expression remains unchanged under different environmental conditions (Lanišnik Rižner, 1999).

Results

Hortaea werneckii contains two copies of Δ9-desaturase, Δ12-desaturase and fatty acid elongase

Genes encoding three different fatty acid-modifying enzymes were identified in H. werneckii using specific oligonucleotide primers. The 415-, 367- and 533-bp-long partial sequences of the genes encoding a Δ9-desaturase, a Δ12-desaturase and a fatty acid elongase were amplified, respectively.

Southern blotting of the genomic DNA suggested that each of the three genes existed in at least two copies in the genome of H. werneckii (Fig. 1). Screening of genomic and cDNA libraries recovered several clones, which were sequenced and assembled into complete (HwOLE1A, HwODE12A, HwODE12B and HwELO1A) or partial (HwOLE1B and HwELO1B) gene and/or cDNA sequences. Searches with blast programs (Altschul, 1997) showed similarities to several genes for Δ9-desaturases, Δ12-desaturases and fatty acid elongases. The genes were named HwOLE1A and HwOLE1B, HwODE12A, and HwODE12B, HwELO1A and HwELO1B, respectively. HwOLE1A encoded a protein consisting of 483 amino acids with a C-terminal cytochrome b5-like domain similar to the same domain in S. cerevisiae Ole1 (Mitchell & Martin, 1995). Comparison of genomic and cDNA sequences did not show any introns. A partial gene sequence of HwOLE1B was obtained, encoding the first 318 amino acids of the enzyme, of which only five were different between the isogenes. Both HwODE12A and HwODE12B (containing a 61-bp-long intron) encoded 483-amino-acid-long proteins, differing in six amino acids. HwELO1A contained an 86-bp-long intron and encoded a 362-amino-acid-long protein. The sequences have been stored in GenBank under the accession numbers AY576801 (HwOLE1A), EU857727 (HwOLE1B), EU863413 (HwODE12A), EU857728 (HwODE12B), AY576803 (HwELO1A) and EU857729 (HwELO1B). Despite several screenings of different libraries, complete sequences for the HwOLE1B and HwELO1B genes could not be obtained; however, the partial sequences were informative enough to allow the successful construction of the primers specific for each isogene mRNA.

1

Determination of the HwOLE1, HwODE12 and HwELO1 gene copies in Hortaea werneckii. Southern blotting of genomic DNA, digested with different restriction endonucleases (EcoRI, HindIII, BamHI and EcoRI+HindIII). Southern blotting of the gels with separately digested DNA was probed with radiolabelled fragments, amplified with oligonucleotide primers specific for parts of the genes in question.

Phylogenetic analysis of fungal fatty acid-modifying enzymes

The amino acid sequences of the identified desaturases and elongase were compared with other known sequences of homologous fungal genes in the databases. Good convergence of the runs was reached when constructing all three of the gene trees with mrbayes. The likelihood values reached plateaus after c. 20 000 (Δ9-desaturases), 25 000 (Δ12-desaturases) and 9000 generations (elongases), while the average SDs of the split frequencies declined below 1% after c. 400 000 (Δ9-desaturases), 200 000 (Δ12-desaturases) and 800 000 (elongases) generations. The first 4000 (Δ9-desaturases), 2000 (Δ12-desaturases) and 8000 (elongases) trees were discarded as burn-in. The posterior probabilities for the amino acid models were 1 for the Blosum62 model (Henikoff & Henikoff, 1992) for Δ9-desaturases and Δ12-desaturases, and 1 for the WAG model (Whelan & Goldman 2001) for elongases. All four deduced proteins with complete sequences from H. werneckii (HwOle1a, HwOde12a, HwOde12b and HwElo1a) shared the greatest similarities with homologous enzymes from fungi belonging to Pezizomycotina and clustered together with homologue genes from the moderately halotolerant melanized yeast-like fungus A. pullulans (Fig. 2).

2

Phylogeny of the Δ9-desaturase (a), Δ12-desaturase (b) and elongase (c) enzymes, constructed from the alignment of the protein sequences retrieved from the GenBank database with the blast programme. Complete protein sequences were used in all alignments, which, in the case of Δ9-desaturase, included a C-terminal cytochrome b5-like domain. Alignments were analysed with the mrbayes software, in two runs, with two million generations and six chains each. A mixed amino acid model was used, while the first 4000 (Δ9-desaturases), 2000 (Δ12-desaturases) and 8000 (elongases) trees were excluded from the final consensus tree. Enzymes from Mortierella alpina were used as outgroups. GenBank accession numbers of proteins used for the construction of the genes' phylogenies are included as supplementary information [Table S1 (Δ9-desaturase), Table S2 (Δ12-desaturase), and Table S3 (elongase)].

The expression of desaturases and elongases in H. werneckii is salt dependent

The relative abundances of all the isogene mRNAs were studied by real-time PCR. The profiles for growth at different salinities and under hyperosmotic and hypo-osmotic shock were analysed. All the primers proved to be of appropriate quality for the real-time PCR, with the exception of primers specific for the HwELO1B isogene, which formed some primer dimers. The primers were used nevertheless, because the similarity of both isogenes did not allow the successful construction of other specific primers. The results are shown in Figs 35.

3

Relative HwOLE1 mRNA abundance determined by real-time PCR. Profiles of isogene A (HwOLE1A) and isogene B (HwOLE1B). The samples were prepared from cells grown at different salinities (a) or subjected to a salinity shift from 0–17% NaCl (b) and 17% to 0% NaCl (c). The mRNA abundances in the cells completely adapted to a final salinity (17% in the case of an up-shift and 0% in the case of a down-shift) are marked with an asterisk. mRNA levels for each isogene are shown in separate rows. Data represent means±SD from two real-time experiments.

4

Relative HwODE1 mRNA abundance determined by real-time PCR. Profiles of isogene A (HwODE12A) and isogene B (HwODE12B). The samples were prepared from cells grown at different salinities (a) or subjected to a salinity shift from 0% to 17% NaCl (b) and 17% to 0% NaCl (c). mRNA abundances in cells completely adapted to the final salinity (17% in the case of the up-shift and 0% in the case of the down-shift) are marked with an asterisk. mRNA levels for each isogene are shown in separate rows. Data represent means±SD of two real-time experiments.

5

Relative HwELO1 mRNA abundance determined by real-time PCR. Profiles of isogene A (HwELO1A) and isogene B (HwELO1B). The samples were prepared from cells grown at different salinities (a) or subjected to a salinity shift from 0% to 17% NaCl (b) and 17% to 0% NaCl (c). mRNA abundances in cells completely adapted to the final salinity (17% in the case of the up-shift and 0% in the case of the down-shift) are marked with an asterisk. The mRNA levels for each isogene are shown in separate rows. Data represent means±SD of two real-time experiments.

The levels of all the isogene mRNAs were the lowest at salinities between 5% and 13% NaCl (w/v). Minima were reached at 13% NaCl for the HwOLE1 isogenes (Fig. 3) and at 5% NaCl for the other four isogenes (Figs 4 and 5). In all cases, the expression at 17% NaCl was higher than at 25% NaCl (w/v).

A sudden shift from 0% to 17% NaCl (w/v) led to an immediate, although moderate, reduction of the expression. The mRNA levels were still low 2 h after the shock, with the exception of the isogene HwOLE1A, which exceeded the starting expression level after 2 h. In the case of HwELO1B, a transient increase was seen after 30 min.

A sudden shift from 17% to 0% NaCl (w/v) caused the most pronounced, but also a more short-lived, response. The strongest repression of genes was already seen 5 min after this shock, when the mRNA levels decreased by 10-fold to 12-fold in the case of the HwODE12B gene and both the HwELO1 isogenes, while for HwODE12A and the HwOLE1 isogenes, the repression was approximately half as strong. After this immediate response, the mRNA levels quickly recovered and reached their starting points 30 min after the down-shift, with the exception of HwELO1B, where the expression observed before this shock was re-established after 10 min. In both the HwOLE1 and the HwODE12 isogenes, 1 h after the downshift, the mRNA levels reached significant (but transient) peaks, with the values being twofold to almost sixfold higher then their starting values.

Discussion

It has been suggested previously that fatty acid modifications serve to increase membrane fluidity at high salt concentrations (Russell, 1989; Hazel & Williams, 1990). In the present study, we have identified and characterized genes encoding Δ9-, Δ12-desaturases and elongases in H. werneckii. According to the Southern blotting, H. werneckii contains at least two copies of each of these genes. The identification of duplicate genes for all three enzymes investigated was in line with previous data on H. werneckii, because several other genes were already found to exist in two copies in this fungus, such as genes encoding HMG-CoA reductase (Vaupotič & Plemenitaš, 2007a), histidine kinase (Lenassi & Plemenitaš, 2007), 3′-phosphoadenosine-5′-phosphatase (Vaupotič, 2007) and ENA ATPases (Gorjan & Plemenitaš, 2006), suggesting larger genomic duplication events in the evolutionary history of the species. In comparison, the salt-sensitive S. cerevisiae has only one Δ9-desaturase and is incapable of Δ12 desaturation (Martin, 2002).

The pairs of proteins encoded by the isogenes for the Δ9- and Δ12-desaturases in H. werneckii were almost identical to each other, indicating a fairly recent duplication event. Phylogenetic analysis of amino acid sequences revealed the evolutionary origin of all three of the enzymes investigated (Δ9-, Δ12-desaturases and elongase) in a Pezizomycotina cluster. The enzymes were closely related to homologous proteins from the black yeast A. pullulans (Gostinčar, 2008).

The phylogenetic analysis of the Δ12-desaturases, Δ9-desaturases and elongases from different fungi indicated other duplication events early in the evolutionary history of these enzymes. In the case of the Δ9-desaturases, a previously unreported duplication was demonstrated in a Saccharomycotina cluster. The phylogeny of the Δ12-desaturases demonstrated a previously reported duplication that took place before the splitting of the Saccharomycotina and Pezizomycotina lineages (Damude, 2006), and confirmed an additional, previously only suspected, duplication in Saccharomycotina. The analysis of the elongases demonstrated a previously described duplication in Saccharomycotina (Gostinčar, 2008) (Fig. 2).

Changes in the expression of fatty acid-modifying enzymes could be a part of the mechanisms that enable precise regulation of membrane fluidity, which is in turn needed for correct functioning of cells in a constantly changing osmotic environment. In H. werneckii, salt-induced changes in the membrane composition are reflected in the plasma membrane fluidity. To overcome the stressful environmental conditions and to maintain the correct membrane fluidity, besides changes in the sterol-to-phospholipid ratio, H. werneckii cells also increased the desaturation levels of the phospholipid fatty acids (Turk, 2004, 2007). Salt-dependent decreases in the palmitic fatty acid (C16:0), together with increases in the linoleic fatty acid (cis-C18:2Δ9,12) (Turk, 2004), suggested increases in the expression profiles of H. wereneckii desaturases and elongases. However, the response of the gene expression was just the opposite. In all cases, except for the HwELO1B gene, where no significant trends were seen, the expression of the genes was the lowest at optimal salinities at values of between 5% and 13% NaCl. Expression at 17% NaCl was again high, and similar to the values detected in the medium without added salt. At 25% NaCl, however, the expression decreased. Specific cellular adaptations have been seen previously in H. werneckii at 17% NaCl (Petrovič, 2002), where the growth starts to slow down (Kogej, 2005), while stress becomes even more severe at 25% NaCl (w/v) (Petrovič, 2006). These conditions might reduce the overall lipid turnover and de novo synthesis, thus also reducing the need for fatty acid modification enzymes. It has also been suggested that at 25% NaCl, internally generated reactive oxygen species (ROS) in H. werneckii cells saturate the ROS-resistance machinery (Petrovič, 2006). Because unsaturated fatty acids are a major target for free radical attacks, which lead to autocatalytic lipid peroxidation (Wiseman & Halliwell, 1996), a higher expression of the desaturases under such extreme concentrations might lead to harmful consequences. Indeed, it has been shown that the content of the major linoleic (cis-C18:2Δ9,12) fatty acid in H. werneckii is lower at 25% than at 17% NaCl (w/v) (Turk, 2004).

Comparisons of the expression profiles of genes encoding desaturases and elongases in H. werneckii with those described in A. pullulans (Gostinčar, 2008) showed significant differences. However, in both cases, the lowest expression levels were seen around the salinity optimum (Kogej, 2005) for each species. In the case of H. werneckii, the lowest values were reached from 5% to 13% NaCl (w/v), and in the case of the halotolerant A. pullulans in medium without salt. It appears that the expression levels of fatty acid-modifying enzymes are not simply reflected in cellular fatty acid composition; instead, they are strongly influenced by the growth speed, salinity optimum and possibly other factors.

The changes in mRNA levels following hyperosmotic shock were similar to the reactions seen for homologous enzymes in A. pullulans (Gostinčar, 2008) and for the S. cerevisiae OLE1 gene (Rep, 2000; Yale & Bohnert, 2001). In all cases, the moderate reduction of expression was followed by a relatively insignificant increase towards the final value. These results suggest a long-term response, as shown for S. cerevisiae in a microarray experiment (Yale & Bohnert, 2001). Changes following the hypo-osmotic shock were much greater, and also much faster. In contrast to the moderately halotolerant A. pullulans (Gostinčar, 2008), in H. werneckii, reduction of mRNA levels of all six isogenes occurred within 30 min of the hypo-osmotic shock. A subsequent increase in expression was detected only at a few time points. These expression profiles show that the reactions to sudden changes in salinity are complex, delayed and quite different from long-term responses in adapted cells. Our results also show that changes in membrane fluidity due to high salinity correlate particularly with long-term responses in the expression profiles of fatty acid-modifying enzymes rather than with short-term responses.

Supplementary material

Table S1. GenBank accession numbers of proteins used for the construction of Δ9-desaturase phylogeny.

Table S2. GenBank accession numbers of proteins used for the construction of Δ12-desaturase phylogeny.

Table S3. GenBank accession numbers of proteins used for the construction of elongase phylogeny.

Acknowledgements

The authors wish to thank Prof. Aharon Oren from The Hebrew University of Jerusalem for critically reading the manuscript. This work was supported by the Ministry of Higher Education and Technology of the Republic of Slovenia in the form of a Young Researcher grant to C. G., and grant no. J1-6715.

Footnotes

  • Editor: Guenther Daum

References

View Abstract