OUP user menu

The oxygen level determines the fermentation pattern in Kluyveromyces lactis

Annamaria Merico, Silvia Galafassi, Jure Piškur, Concetta Compagno
DOI: http://dx.doi.org/10.1111/j.1567-1364.2009.00528.x 749-756 First published online: 1 August 2009

Abstract

Yeasts belonging to the lineage that underwent whole-genome duplication (WGD) possess a good fermentative potential and can proliferate in the absence of oxygen. In this study, we analyzed the pre-WGD yeast Kluyveromyces lactis and its ability to grow under oxygen-limited conditions. Under these conditions, K. lactis starts to increase the glucose metabolism and accumulates ethanol and glycerol. However, under more limited conditions, the fermentative metabolism decreases, causing a slow growth rate. In contrast, Saccharomyces cerevisiae and Saccharomyces kluyveri in anaerobiosis exhibit almost the same growth rate as in aerobiosis. In this work, we showed that in K. lactis, under oxygen-limited conditions, a decreased expression of RAG1 occurred. The activity of glucose-6-phosphate dehydrogenase also decreased, likely causing a reduced flux in the pentose phosphate pathway. Comparison of related and characterized yeasts suggests that the behavior observed in K. lactis could reflect the lack of an efficient mechanism to maintain a high glycolytic flux and to balance the redox homeostasis under hypoxic conditions. This could be a consequence of a recent specialization of K. lactis toward living in a niche where the ethanol accumulation at high oxygen concentrations and the ability to survive at a low oxygen concentration do not represent an advantage.

Keywords
  • Kluyveromyces lactis
  • fermentation
  • ethanol
  • redox
  • hypoxia

Introduction

The majority of eukaryotes need oxygen for their growth. However, several yeast lineages can proliferate under hypoxic and anaerobic conditions (Merico., 2007). The ability to grow under anaerobic conditions depends on several factors, environmental, genetic and metabolic. A good capacity to ferment sugars to ethanol does not necessarily imply that a yeast also has the ability to grow under anaerobic conditions. Actually, most facultative fermentative yeasts do not grow in the absence of oxygen, not even on complex media (Visser., 1990). The ability to grow at a low oxygen concentration rather represents a metabolic skill based on specific enzymatic and transport activities as well as specific regulatory circuits. In short, anaerobiosis imposes a number of challenges to the cell, ranging from the ability to synthesize essential cellular compounds for which molecular oxygen is required, such as sterols and unsaturated fatty acids, to the ability to maintain the cellular redox potential and the essential mitochondrial functions (Sabová., 1993; Ansell., 1997; Nissen., 2000; Rosenfeld & Beauvoit, 2003).

Saccharomyces cerevisiae as well as several other Saccharomyces/Kluyveromyces yeasts can grow under anaerobic conditions. A recent comparative study (Merico., 2007) showed that especially yeasts belonging to the lineage that underwent whole-genome duplication (WGD), an event that occurred around 150 million years ago (Wolfe & Shields, 1997; Kellis., 2004), followed by the rewiring of transcriptional networks and by the evolution of new proteins (Ihmels., 2005; Piškur., 2006), are capable of an efficient fermentative and anaerobic life style. Kluyveromyces lactis belongs to the Saccharomyces/Kluyveromyces complex, but it diverged from S. cerevisiae before the WGD (Wolfe & Shields, 1997). Most K. lactis strains can grow on glucose in the presence of respiratory inhibitors (antimycin A, oligomycin, etc.), but fail to grow efficiently under strict anaerobic conditions on synthetic media, even in the presence of ergosterol and unsaturated fatty acids (Wésolowski-Louvel., 1996; Kiers., 1998). A very slow growth has been observed under conditions of strict anaerobiosis on complex media (Merico., 2007). Saccharomyces kluyveri, a close relative of K. lactis, ferments well and can efficiently grow under anaerobic conditions (Møller., 2001, 2002). Therefore, it is not clear whether the aerobic nature of K. lactis is an original trait or a recently derived one.

Classical physiological and biochemical analysis as well as more recent microarray studies in S. cerevisiae revealed that oxygen indirectly controls the expression of a set of genes through heme. When oxygen availability declines below a certain level, heme synthesis stops and this results in the deactivation of transcriptional factors such as ROX1, encoding a repressor of anaerobic genes (Zitomer & Lowry, 1992; Zitomer., 1997; Kwast., 2002). A recent transcriptomic study showed that the response to oxygen depletion consists of a short-term response, in which ‘stress-like’ factors are also involved, and a chronic response, largely controlled by the heme-responsive transcription factors (Lai., 2005, 2006). The mRNA levels of several K. lactis genes respond to oxygen and heme availability (Kiers., 1998; Destruelle., 1999; González-Domínguez., 2000). Recently, a microarray study on K. lactis response to the hypoxic stress indicated that the mRNA level of the KlROX1 gene, which has low sequence similarity to the S. cerevisiae orthologue, seems not to decrease during hypoxia (Blanco., 2007).

In order to gain more insight into the mechanism of fermentative lifestyle evolution in the Saccharomyces complex, in the present work, we investigated the fermentative ability of K. lactis under different conditions of oxygen availability and compared the results with other well-studied yeasts.

Materials and methods

Yeast strains and media

Kluyveromyces lactis CBS 2359 was used throughout this work. All experiments were performed on the defined synthetic minimal medium described by Verduyn. (1992), supplemented with nicotinic acid (3.5 mg L−1) (Kiers., 1998) and, specifically to avoid nutrient deficiency under oxygen-limited conditions, with ergosterol (10 mg L−1), Tween 80 (420 mg L−1) and uracil (50 mg L−1) (Merico., 2007). Glucose (20 g L−1) was used as the sole carbon source.

To test yeast response to a reduced respiratory activity, antimycin A (5 μM) was added. When specified in the text, acetoin at a concentration of 6 g L−1 was added as well.

Shake-flask cultivations

Shake-flask cultures were run at 30 °C and 200 r.p.m. in a rotative shaker, starting from preinocula grown on the defined synthetic minimal medium described above. All experiments were conducted in 100 mL of medium in 500-mL flasks, and growth parameters were calculated within a biomass range from 0.1 to 1.0 OD660 nm (see Determination of cell density) to ensure fully aerobic conditions.

Batch cultivations in a fermentor

Batch cultivations were performed in a Biostat-Q-system (B-Braun) with a working volume of 0.8 L. A temperature of 30 °C and a stirring rate of 500 r.p.m. were maintained throughout the experiment. Automatic addition of 2 M KOH maintained the medium pH at 5.0 during cell growth. Foaming was controlled by the addition of a silicon antifoaming agent (BDH) to give a final concentration of 0.1 g L−1. Prehumidified air was injected to maintain the dissolved oxygen concentration at 100% of air saturation until the inoculum. Yeast cultures were started from frozen cells, and incubated for one night in the same medium as later used during the experiment to obtain an exponentially growing and preadapted biomass. At time 0, the cells were inoculated at a concentration of 0.25 OD660 nm mL−1 (low cell concentration experiments) or 8 OD660 nm mL−1 (high cell concentration experiments). Any direct air supply was available during all the experiments. To avoid strict anaerobic conditions, nitrogen was not supplied too, and the fermentor was equipped with silicon tubes, instead of Norprene tubes usually used to obtain strict anaerobic conditions. In this way, a very low amount of air could also diffuse across the silicon tubes and thus the presence of a low level of dissolved oxygen, facilitated by continuous stirring in the fermentor, was promoted during all the experiments. At the time of inoculum, the dissolved oxygen concentration detected by the oxygen sensor was 100% of the air saturation, but it declined to 0.2% in 30 min (low cell concentration) and below the oxygen sensor sensitivity in 3 min (high cell concentration), due to cell respiration and growth.

Growth parameters were monitored for 8 h from the inoculum.

Determination of cell density

Cell growth was monitored by measuring the OD660 nm using a Ultraspec 2100 pro spectrophotometer (Amersham Pharmacia Biotech). Parallel samples varied about 3–5%. One OD unit corresponds to a dry weight of 0.295 g L−1.

Extracellular metabolites

Samples were quickly withdrawn from batch cultures during exponential growth at appropriate intervals and centrifuged for 2 min at 15 700 g to discard cellular pellets. The concentrations of glucose, ethanol and glycerol in the supernatants were determined using R-Biopharm Italia enzymatic kits (code 716251, 176290 and 148270, respectively). All samples were analyzed in triplicate, and the SD varied between 1% and 2%.

Preparation of cell extracts and enzyme assays

Cell extracts were prepared essentially as described by Postma. (1989), with the exception that cells were disrupted by agitation with glass beads on a vortex (alternating 1 min in ice and 1 min on vortex for five times) instead of using sonication. The total protein content was determined using the Bio-Rad Protein Assay kit (code 500-0006; Bio-Rad), using bovine serum albumin as a standard.

A unit of enzyme activity is defined as 1 μmol of substrate transformed per minute using an extinction coefficient for NADH of 6.22 L mmol−1 cm−1. Enzyme assays were performed in triplicate, and the values of SD obtained varied between 2.5% and 6%.

Alcohol dehydrogenase (ADH), pyruvate decarboxylase, hexokinase and glucose-6-phosphate dehydrogenase (G6PDH) assays were performed as described by Postma. (1989) and by de Jong-Gubbels. (1995).

For glycerol-3-phosphate dehydrogenase (GPD), cell extracts were prepared and desalted essentially as described by André. (1991), with the exception that cells were disrupted by agitation with glass beads on the vortex as described above. The GPD assay was performed in TrED buffer (triethanolamine 10 mM, EDTA 1 mM and dithiothreitol 1 mM, pH 7.5), MgCl2 1 mM and NADH 0.1 mM. The reaction was started by the addition of dihydroxyacetone phosphate 0.67 mM.

Total RNA isolation and semi-quantitative reverse transcriptase (RT)-PCR

Total RNA was isolated from 1.5 mg (dry weight) of cells using the RNeasy Mini Kit (code 74104, Qiagen) and treated with RNAse-free DNAse I to eliminate DNA contamination according to the manufacturer's suggestions. An incubation at 65 °C for 15 min ensured the inactivation of the DNAse I before the subsequent step of purification. RNA was quantified by spectrophotometry and its quality was checked by gel electrophoresis.

Semi-quantitative RT-PCR was performed according to the method described by Choquer. (2003). mRNAs were amplified using the Ready-to-Go RT-PCR Beads kit (code 27-9266-01, GE-Healthcare) in a Mastercycler (Eppendorf) with 10–40 ng of total RNA as a template into a final volume of 50 μL. Primers were used in different amounts: 25 pmol of the KlRAG1 primers (RAG1-for: CTGCAGGTAACGCATCATG, RAG1-rev: GCCATTGCCTTACCCTTAAC) and 15 pmol of the KlACT1 internal control primers (ACT1-for: CCTTCTACGTCTCTATCCAAGC, ACT1-rev: GTGATAACTTGGCCATCTGG). Synthesis of cDNA was performed at 45 °C for 30 min before inactivation of RT at 95 °C for 5 min. Amplification of cDNA by PCR was performed for 1 min at 95 °C, 45 s at 52 °C and 1 min at 72 °C for 30 cycles.

Detection of contaminating DNA in all total RNA samples was performed in RT-PCR reaction mixtures in which the RT was inactivated before the cDNA synthesis step.

Amplification efficiencies were evaluated by gel electrophoresis and densitometric analysis using the kodak 1dimage analysis software (Kodak). The results, expressed in arbitrary units ± SD, are given as the mean ratio between the fluorescence of the target gene and the internal standard of at least three independent experiments. The anova and the P-value were calculated using the statadvisor software. A calculated P-value <0.0001 indicated statistical significance at the 95% confidence level.

Results

Growth under conditions of reduced respiratory activity

In our previous work, we reported that the addition of acetoin or some amino acids allowed K. lactis to grow in the presence of a high concentration of antimycin A (Merico., 2007). This prompted us to study in more detail the growth of K. lactis under conditions of reduced respiratory activity. Antimycin A blocks the respiratory activity. When 5 μM antimycin A was present in the medium, K. lactis grew at a reduced specific growth rate (0.15 h−1 in the presence and 0.50 h−1 in the absence of antimycin A), and produced ethanol (Table 1). Under this condition, the specific glucose consumption rate (mmol glucose g–1 dry weight h–1) was two times higher than in the absence of the drug, as expected due to the fermentative metabolism (Table 1). At the same time, glycerol formation enabled the reoxidation of the surplus of NADH generated during the anabolic reactions associated with the biomass production (Table 1). This NADH could not be drained otherwise because of the reduced activity of the respiratory chain.

View this table:
1

Comparison of the growth parameters of Kluyveromyces lactis cultivated under aerobic conditions without respiration inhibitors and under conditions of reduced respiratory activity in presence of antimycin A and in presence of antimycin A plus acetoin

Growth conditionsSpecific rate of growth (h−1)Yield (g g−1 glucose) q (mmol g−1 dry weight h−1)
BiomassEthanolGlycerolGlucoseEthanolGlycerol
Without respiration inhibitors0.500.400011.9500
With antimycin A0.150.040.350.1023.0031.744.52
With antimycin A and acetoin0.260.060.340.0223.4031.090.75

The addition of acetoin, which works as a cytoplasmic redox sink through its conversion to butanediol catalyzed by an NADH-dependent reaction (González., 2000), resulted in an increase in the specific growth rate (Table 1). Neither the specific glucose consumption rate nor the specific ethanol production rate increased, but a decreased glycerol production, both in terms of the specific rate of production and yield, was observed. As a consequence, the biomass yield increased. Taking into consideration that glycerol production is an energy-consuming reaction, the positive effect of the acetoin on the growth rate did not result from a higher fermentative activity, but was likely due to the reduced production of glycerol, which leaves more ATP for the growth.

Growth under conditions of oxygen limitation

The growth in the presence of inhibitors of the respiratory chain can be very different from the growth under the condition of a real oxygen limitation. In order to investigate the response of K. lactis under limited oxygen availability, we performed experiments in a fermentor in the absence of air supply and nitrogen flux, to avoid strict anaerobic conditions. Furthermore, the presence of the silicon tubes and continuous stirring in the fermentor allowed some oxygen diffusion and the presence of a very low level of dissolved oxygen (Visser., 1990; for more details, see also Materials and methods). At the time of the inoculation, the dissolved oxygen concentration was 100% of the air saturation, but it declined to 0.2% in 30 min, due to cell respiration and growth. Under these conditions, K. lactis exhibited a respiro-fermentative metabolism and grew exponentially at a specific rate of 0.26 h−1 (Table 2, phase I). As already observed in the presence of antimycin A, oxygen limitation reduced the specific growth rate, but to a lesser extent than in the case of antimycin A. The specific glucose consumption rate was almost three times higher than in aerobiosis but also higher than in the presence of antimycin A, resulting in a higher ethanol and glycerol production rate (for a comparison, see Tables 1 and 2). As the biomass increased, the condition of oxygen limitation became more stringent in the bioreactor, because an increased number of cells consumed the very low amount of the oxygen diffusing across the tubes and dissolved in the medium. At this point, the dissolved oxygen level actually declined below the detection limit of the oxygen probe. This more oxygen-limited condition determined a further decrease of the growth rate and also caused, surprisingly, a decrease of the specific glucose consumption rate (Table 2, phase II). This could not have been due to a decreased glucose concentration in the medium, because this was still sufficiently high to maintain the low-affinity glucose transporter RAG1 being induced (Chen., 1992). As a consequence of the reduced flux of glucose, the specific ethanol production rate decreased, and the glycerol production rate decreased as well (Table 2, phase II). In terms of yields, all the parameters (biomass, ethanol and glycerol) reached almost the same values as already observed during growth in the presence of antimycin A.

View this table:
2

Growth parameters of Kluyveromyces lactis cultivated under conditions of oxygen limitation at low cell concentration and at high cell concentration, with and without acetoin

Growth conditionsSpecific rate of growth (h−1)Yield (g g−1 glucose) q (mmol g−1 dry weight h−1)
BiomassEthanolGlycerolGlucoseEthanolGlycerol
Low cell concentration
Phase I: 0.40–0.85 OD0.260.040.340.1034.9846.486.69
Phase II: 1.24–2.45 OD0.230.050.360.0727.7838.893.70
Low cell concentration plus acetoin, 0.48–2.26 OD0.310.100.290.0417.1844.091.82
High cell concentration, 9.12–16.70 OD0.160.100.380.099.4014.011.71
High cell concentration plus acetoin, 10.00–19.60 OD0.230.130.380.039.8814.620.59

The addition of acetoin under these conditions elicited a response similar to the one that occurred in the experiment performed in the presence of antimycin A. It caused an increase in the specific growth rate that could be maintained throughout the experiment and a strong decrease in the glycerol consumption rate without influencing the fermentative activity (Table 2). Yields were influenced as well: lower ethanol and glycerol yields resulted in a higher biomass yield (Table 2).

Growth under more oxygen-limited conditions

The observation that the oxygen limitation affected glucose metabolism and fermentative activity needed further investigations. It is known that K. lactis is unable to grow under strict anaerobic conditions on synthetic media even in the presence of sterols and fatty acids (Kwast., 2002). In order to test the K. lactis response under more oxygen-limited conditions, cells were inoculated in the fermentor at higher cell concentrations (Fig. 1). In this set of experiments, the same level of dissolved oxygen as that described in the above experiment was available, but for a higher amount of cells, thus providing a more stressful condition of oxygen-limited growth. Noticeably, the dissolved oxygen concentration declined below the oxygen sensor sensitivity already after 3 min from the inoculation. In this way, furthermore, the cells grew in a fresh medium and then at the appropriate glucose concentration for the RAG1 induction and without the presence of byproducts that could affect the growth, as actually occurs when such a concentration of cells is obtained after a prolonged growth in the same medium.

1

Growth of Kluyveromyces lactis under conditions of oxygen limitation inoculated at a high cell concentration: ▪, biomass; ♦, glucose; ▲, ethanol; and △, glycerol.

Under this condition, K. lactis grew with a specific growth rate that was lower than under the less oxygen-limited condition (Table 2). The specific glucose consumption rate did not show any increase, and interestingly, it was even lower than during the growth in the presence of antimycin A (Tables 1 and 2). The specific ethanol and glycerol production rates were the lowest as well (Tables 1 and 2). The same kind of results were obtained when the fermentor was inoculated with half the amount of yeast cells (OD=5, data not shown).

The addition of acetoin also in this case helped to increase the growth rate (Table 2), despite the fact that the glucose consumption rate and ethanol production rate did not rise. As observed under the less oxygen-limited condition, the main effect elicited by acetoin was the reduction of glycerol production, in terms of both productivity and yield.

Enzyme activities and RAG1 expression

To verify how the induction of the fermentative metabolism is related to the activity of involved enzymes under the different conditions of growth, several of them were analyzed (Table 3). As expected, and already reported (Kiers., 1998), pyruvate dehydrogenase and ADH activities increased during the growth under limited oxygen conditions. The activity of GPD increased under limited oxygen conditions as well and this correlated with the observed glycerol production. An increased activity of hexokinase was detected, but only under the more oxygen-limited condition, despite the lower glycolytic flux observed under this condition. It is noteworthy that G6PDH activity reduced to half under the oxygen-limited condition in comparison with the aerobic conditions (Table 3).

View this table:
3

Analysis of the activities of pyruvate decarboxylase (PDC), alcohol dehydrogenase (ADH), GPD, hexokinase (HXK) and G6PDH and of RAG1 expression under aerobic conditions and under conditions of oxygen limitation

Growth conditionsEnzyme activity (U mg−1)mRNA expression (AU)
PDCADHGPDHXKG6PDHRAG1
Aerobiosis0.57 ± 0.011.86 ± 0.110.005 ± 0.0010.85 ± 0.011.23 ± 0.091.06 ± 0.10
Low cell concentration0.85 ± 0.014.47 ± 0.260.93 ± 0.050.59 ± 0.04
High cell concentration1.24 ± 0.067.09 ± 0.520.046 ± 0.0011.7 ± 0.080.60 ± 0.040.64 ± 0.21
  • * P-value <0.0001.

The observed variations in the glucose consumption rate in relation to the oxygen availability suggested that RAG1 could be regulated by oxygen concentration. The analysis of the RAG1 transcript level indicated that a repression of RAG1 occurred during the growth under limited availability of oxygen. The difference in the observed values was approximately two times (Table 3).

Discussion

A recent survey on the hypoxic and oxidative stress response in K. lactis (Blanco., 2007) showed that one of the hypoxia-induced genes is KlGCR1, coding for a positive regulator of glycolytic genes (Neil., 2004). This can indicate that, as in S. cerevisiae, the glycolytic flux is stimulated under hypoxia, as expected due to the lower energetic efficiency of fermentation over respiration. Our experiments proved that K. lactis, similar to S. cerevisiae, increases its glucose metabolism and accumulates ethanol and glycerol in response to a reduced oxygen availability/respiratory activity (Tables 1 and 2). The glucose consumption rate was substantially higher under oxygen-limited conditions or in the presence of respiration inhibitors than under fully aerobic conditions, but this relationship seems to be strictly correlated to the oxygen level. In fact, when the availability of oxygen becomes increasingly growth limiting, the glycolytic flux decreases (Table 2). This is in contrast to the properties of S. cerevisiae and S. kluyveri, both of which, under anaerobic conditions, increase their glucose metabolism and therefore maintain almost the same growth as the one under aerobic conditions (Table 4). It is noteworthy that in K. lactis, the reduced glucose consumption rate occurred together with a decreased level of expression of the major glucose transporter RAG1 (Table 3). Recently, it has been reported that KlHap1p represses the expression of RAG1, thus reducing the glucose uptake rate (Bao., 2008). In the same work, the transcription of KlHAP1 has been shown to be increased under hypoxia. The authors have suggested that this regulation helps to maximize the respiratory pathway and minimize the fermentation. Furthermore, it seems that the spectrum of the target genes regulated by KlHAP1 and its mode of regulation in K. lactis deviates from the HAP1 gene in S. cerevisiae (Lamas-Maceiras., 2007; Bao., 2008). In K. lactis, the transport of other sugars, such as galactose, raffinose and maltose, has also been correlated with a reduced uptake capacity in the presence of respiration inhibitors, leading to the so-called Kluyver effect (Goffrini., 2002; Fukuhara, 2003). Apparently, the action of HAP1 on the sugar uptake and on several other pathways, and its correlation with the presence of oxygen, may represent the main and crucial difference between S. cerevisiae and K. lactis.

View this table:
4

Comparison of growth parameters under strict anaerobic or oxygen-limited conditions in three different yeasts (data in parentheses obtained under aerobic conditions)

S. cerevisiaeS. kluyveriK. lactis
μmax (h−1)0.35 (0.38)0.24 (0.47)0.16 (0.5)
q glu (mmol g−1 dry weight h−1)26.8 (13.2)14.9 (8.7)9.4 (11.95)
q EtOH (mmol g−1 dry weight h−1)35.4 (21.8)20.5(3.4)14 (0)
q gly (mmol g−1 dry weight h−1)4.17 (1.98)3 (0.4)1.7 (0)
Biomass yield (g g−1 glucose)0.08 (0.11)0.089 (0.29)0.1 (0.4)
EtOH yield (g g−1 glucose)0.4 (0.34)0.35 (0.1)0.38 (0)
  • * Saccharomyces cerevisiae and Saccharomyces kluyveri were studied under strict anaerobic conditions, and Kluyveromyces lactis under oxygen-limited conditions. Saccharomyces kluyveri: data from Møller. (2001).

The growth under oxygen-limited condition requires the cell to solve a second but equally strategic problem: the maintenance of the redox homeostasis. Under the limiting oxygen availability, S. cerevisiae achieves its redox balance by producing glycerol (Nissen., 2000; Rigoulet., 2004). The redox balance also needs to be maintained inside the mitochondria, for the assimilatory reactions. To restore this balance, when the respiration is limited by oxygen, NADH must be transported to the cytosol and oxidized via formation of glycerol. In S. cerevisiae, different shuttle systems have been described that generate an NAD/NADH gradient across the inner mitochondrial membrane. One is the dihydroxyacetone phosphate–glycerol-3-phosphate, catalyzed by the cytoplasmic GPD1 product, and the mitochondrial GPD2 product, which has been shown to be induced specifically under anaerobiosis (Ansell., 1997). The ethanol–acetaldehyde shuttle has also been reported to be involved and ADH3 is induced by anaerobiosis (Bakker., 2000; Overkamp., 2000). Similarly, FRDS1 and OSM1, coding for the cytoplasmic and mitochondrial form of fumarate reductase, are under the control of the oxygen presence (Camarasa., 2007). In the K. lactis genome, we found only one gene with a high identity to S. cerevisiae GPD1/2 and a single gene with a high identity to OSM1/FRDS1. However, we observed a higher activity of GPD under oxygen limitation, indicating that the unique copy of KlGPD is induced by hypoxia (Table 3). Nevertheless, in K. lactis under hypoxia, the glucose consumption rate and the glycerol flux decrease and, as a consequence, this can cause a redox imbalance at both the cytoplasmic and the mitochondrial level.

On the other hand, a reduced production of glycerol in the presence of acetoin leaves more ATP for the growth and therefore enables a higher growth rate and a higher biomass yield (Tables 1 and 2). These data are in agreement with our previous observations that the presence of acetoin allows K. lactis to grow in the presence of higher antimycin A concentrations (Merico., 2007).

In K. lactis, the pentose phosphate pathway (PPP) contributes substantially to glucose metabolism, more than in S. cerevisiae (González-Siso., 2000). It has therefore been proposed that the high respiratory capacity of K. lactis serves the maintenance of an operative PPP (Tarrío., 2006). In fact, the NADPH produced by this pathway is reoxidized by the external NAD(P)H: ubiquinone oxidoreductase, encoded by KlNDE1, promoting the required NADPH/NADP turnover (Tarrío., 2005). As a consequence, in Klpgi1 (rag2) mutants, fermentation becomes respiration dependent. Furthermore, Klzwf1 mutants have been described to be more sensitive to antimycin A and to produce a very low level of ethanol, suggesting that PPP is also required to achieve ethanol accumulation (Saliola., 2007). We detected a reduction of G6PDH activity under oxygen-limited conditions in comparison with the aerobic conditions (Table 3). The reduction of the NADPH reoxidation could then result in the reduction of the PPP flux.

In conclusion, the availability of oxygen determines the fermentation pattern in K. lactis. The increase of the glucose consumption rate in response to the reduced oxygen level is a transient effect in this yeast, in contrast to what occurs in Crabtree-positive yeasts. In fact, when the availability of oxygen decreases, an overall reduction of the glucose metabolism occurs, which in turn leads to a reduced fermentation activity. A redox imbalance, caused by the reduced respiratory activity and by the decreased glycolytic flux, also results. It remains unclear at present as to what is the nature of the signal that triggers the response to hypoxia. The evolution of a fermentative lifestyle is undoubtedly associated with the capacity to become independent from the oxygen availability. This skill is strictly correlated with the possibility to regulate gene expression and it is assisted by the presence of multiple genes differently expressed under aerobic/anaerobic conditions, as it occurs in S. cerevisiae. Our observations show that K. lactis has the ability to upregulate its fermentative metabolism under conditions of reduced oxygen availability as S. cerevisiae, but suggest the predominance of other regulatory mechanisms that later lead to a reduction of the glycolytic flux. Thus, the glucose metabolism in the presence of oxygen is preferentially respiratory, and under very limited oxygen conditions, the yeast's ability to grow and proliferate is diminished. This could be a consequence of a recent specialization of K. lactis toward living in a niche where the ethanol accumulation at high oxygen concentrations and the ability to survive without oxygen do not represent an advantage. Alternatively, K. lactis could exhibit the original yeast traits, which were associated with the Crabtree-negative effect and the inability to propagate without oxygen. However, the ability of other closely related yeasts to grow under anaerobic conditions (Merico., 2007) rather excludes this possibility.

Acknowledgement

We thank Roberto Foschino (University of Milan) for his assistance in statistical analysis.

Footnotes

  • Editor: Monique Bolotin-Fukuhara

References

View Abstract